RegulonDB RegulonDB 10.8: Gene Sequence
hcaF gene sequence


Size: 519        A: 139  T: 109  G: 130  C: 141

Fasta

 

>hcaF E. coli K12. Version NC_000913.3 GI:556503834
atgagtgcgcaagtttcactagagttacatcaccgcattagccagtttctctttcacgaa
gccagcttactggacgactggaaatttcgtgactggctggcgcagctcgacgaagagatt
cgttacaccatgcgcaccacagttaacgcgcaaacacgcgaccgccgcaaaggcgtccag
ccaccgacaacctggatttttaatgacaccaaagaccagctggagcggcgaatcgcccgt
ctggaaacgggcatggcctgggcagaagagccgccgtcacgcacccgtcacttaatcagc
aactgccagataagcgaaaccgacatcccaaacgtatttgctgtgcgggtaaattatctg
ctttatcgggcacaaaaagagcgcgatgaaacattctatgttggaacgcgtttcgacaaa
gttcgccgtctggaagatgacaactggcgcttgctggaacgggatatcgtcctggatcaa
gcggtaatcacttcccataacctgagtgtactgttctga
              
                            

Download fasta file
RegulonDB