RegulonDB RegulonDB 10.8: Gene Sequence
ylcG gene sequence


Size: 141        A: 34  T: 40  G: 35  C: 32

Fasta

 

>ylcG E. coli K12. Version NC_000913.3 GI:556503834
atgatgtttgagtttaatatggcagaacttcttcgccaccgctgggggcgtctgcgctta
tatcgtttccccggttctgttttgaccgattaccgaatactgaagaattacgccaaaacc
ctgacaggagcaggagtatga
              
                            

Download fasta file
RegulonDB