RegulonDB RegulonDB 10.8: Gene Sequence
ynfO gene sequence


Size: 234        A: 85  T: 45  G: 49  C: 55

Fasta

 

>ynfO E. coli K12. Version NC_000913.3 GI:556503834
atgtcaacgaagaacagaacccgcagaacaacaacccgcaacatccgctttcctaaccaa
atgattgaacaaattaacatcgctcttgagcaaaaagggtccgggaatttctcagcctgg
gtcattgaagcctgccgccggagactgtgctcagaaaaaagagtttcttctgaagcaaac
aaagaaaagagtgacattactgaattgctcagaaaacaggtcagaccagattga
              
                            

Download fasta file
RegulonDB