RegulonDB RegulonDB 10.10: Gene Sequence
yecJ gene sequence


Size: 252        A: 66  T: 64  G: 56  C: 66

Fasta

 

>yecJ E. coli K12. Version NC_000913.3 GI:556503834
atgtcccagccgctgaatgccgatcaggaattggtttctgatgtggttgcttgccagttg
gttatcaaacaaattctggatgttctcgatgtaatcgcgcccgttgaagttcgtgaaaaa
atgtccagtcagctgaagaatatcgactttactaaccatcccgccgccgcagacccggtc
accatgcgggcaatccaaaaagccatcgcgcttattgaactcaagtttaccccacagggt
gaatcccattaa
              
                            

Download fasta file
RegulonDB