RegulonDB RegulonDB 10.9: Gene Sequence
ypeB gene sequence


Size: 219        A: 61  T: 45  G: 62  C: 51

Fasta

 

>ypeB E. coli K12. Version NC_000913.3 GI:556503834
atggaaaaagagcagctgattgaaatagccaatacgataatgccgtttggcaaatacaaa
gggcgtcgcttaatcgacctgccggaggagtatctgctgtggtttgcccgcaaagatgag
ttcccggcagggaagctcggtgagctaatgcaaatcacgctgctgattaaaaccgagggg
ctgacgcaactggtccagcccctgaagcgtccgctttaa
              
                            

Download fasta file
RegulonDB