RegulonDB RegulonDB 10.9: Gene Sequence
yifL gene sequence


Size: 204        A: 56  T: 41  G: 47  C: 60

Fasta

 

>yifL E. coli K12. Version NC_000913.3 GI:556503834
atgaaaaacgtgtttaaggcactcactgtattacttactctcttcagcctgacgggctgc
ggtctgaaaggtccgctctatttcccgcctgcagataaaaacgcaccgccgccgaccaaa
ccggtagagacgcaaacgcaatccacggtgccggataaaaacgatcgcgccactggcgat
ggtccatcccaggtgaattactaa
              
                            

Download fasta file
RegulonDB