RegulonDB RegulonDB 10.8: Gene Sequence
ylcH gene sequence


Size: 102        A: 26  T: 26  G: 21  C: 29

Fasta

 

>ylcH E. coli K12. Version NC_000913.3 GI:556503834
atgcgcacatacaatccaaactctcttctcccttcacagatgcagaaatgcacctgcaat
tctttgcatctagcgtttgacctctgcggaggggaagcgtga
              
                            

Download fasta file
RegulonDB