RegulonDB RegulonDB 10.10: Gene Sequence
ilvX gene sequence


Size: 51        A: 20  T: 12  G: 10  C: 9

Fasta

 

>ilvX E. coli K12. Version NC_000913.3 GI:556503834
atgaataacagcacaaaattctgtttctcaagattcaggacggggaactaa
              
                            

Download fasta file
RegulonDB