RegulonDB RegulonDB 10.8: Gene Sequence
ypdK gene sequence


Size: 72        A: 13  T: 31  G: 16  C: 12

Fasta

 

>ypdK E. coli K12. Version NC_000913.3 GI:556503834
gtgaaatatttctttatgggcatttcttttatggtcatcgtttgggccggtacttttgcc
ctgatgatctaa
              
                            

Download fasta file
RegulonDB