RegulonDB RegulonDB 10.9: Gene Sequence
yrbN gene sequence


Size: 81        A: 24  T: 25  G: 18  C: 14

Fasta

 

>yrbN E. coli K12. Version NC_000913.3 GI:556503834
atgaaaattgctgatcaatttcatgatgagttatgtagactggccgccattaattttgag
gcacacgtactacatggctga
              
                            

Download fasta file
RegulonDB