RegulonDB RegulonDB 10.8: Gene Sequence
yqcG gene sequence


Size: 141        A: 56  T: 51  G: 16  C: 18

Fasta

 

>yqcG E. coli K12. Version NC_000913.3 GI:556503834
atgtcagaagaaaataaagaaaatggatttaatcatgtcaaaacattcaccaaaattata
tttattttttctgtattagtttttaatgataacgaatataaaattaccgatgccgccgtc
aatttatttatccagatttaa
              
                            

Download fasta file
RegulonDB