RegulonDB RegulonDB 10.9: Gene Sequence
sokX gene sequence


Size: 56        A: 9  T: 18  G: 18  C: 11

Fasta

 

>sokX E. coli K12. Version NC_000913.3 GI:556503834
gtttgggttcgaacgctggcctcaggttgatagaaatatcgcctggggcttttgtc
              
                            

Download fasta file
RegulonDB