RegulonDB RegulonDB 10.8: Gene Sequence
sdsN gene sequence


Size: 137        A: 32  T: 49  G: 31  C: 25

Fasta

 

>sdsN E. coli K12. Version NC_000913.3 GI:556503834
attcaggcaatgaattacttttgcaagccatcgcattctcttatgttattaatgagttat
gctgatttgttaagcagttttatcaggcttgaaatggcgtccagccccgacaggtgaatc
gtcggggctgatttttt
              
                            

Download fasta file
RegulonDB