RegulonDB RegulonDB 10.8: Gene Sequence
mntS gene sequence


Size: 129        A: 38  T: 38  G: 28  C: 25

Fasta

 

>mntS E. coli K12. Version NC_000913.3 GI:556503834
atgaatgagttcaagaggtgtatgcgcgtgtttagtcattctccctttaaagtacggtta
atgctgctctctatgttgtgcgatatggtcaacaacaaaccgcagcaagataaaccttcc
gataaatag
              
                            

Download fasta file
RegulonDB