RegulonDB RegulonDB 10.8: Gene Sequence
iroK gene sequence


Size: 66        A: 18  T: 15  G: 18  C: 15

Fasta

 

>iroK E. coli K12. Version NC_000913.3 GI:556503834
atgaagccggcattacgcgatttcatcgccattgtgcaggaacgtttggcaagcgtaacg
gcataa
              
                            

Download fasta file
RegulonDB