RegulonDB RegulonDB 10.8: Gene Sequence
nc9 gene sequence


Size: 111        A: 25  T: 24  G: 36  C: 26

Fasta

 

>nc9 E. coli K12. Version NC_000913.3 GI:556503834
ggcagcgacgccggtgagctggccggagccgggaaaacaggcgttaccgtgcaaagcagc
ctcgatgcggtaaaagatgattttgatgtgtttatcgattttacccgtccgg
              
                            

Download fasta file
RegulonDB