RegulonDB RegulonDB 10.8: Gene Sequence
ypjI gene sequence


Size: 272        A: 59  T: 63  G: 78  C: 72

Fasta

 

>ypjI E. coli K12. Version NC_000913.3 GI:556503834
atgagcaactctgaaggttggtagtcattttagcaaacgctttctggtctgccgcagtgg
gcatcggctgattgcgtagcagggccactggtatctgccggtatcaccgacattaacatt
gaagacgaccagggcattcacgtccgcctgatagttcgtgatgccgaaggtcggatggtt
ggcgggcatggaactttgaaccggacgccggtgaaggttttaaccgctatatccacaggt
caggcatccgcaccgacaccttcccccgctga
              
                            

Download fasta file
RegulonDB