RegulonDB RegulonDB 10.9: Gene Sequence
rirA gene sequence


Size: 73        A: 14  T: 25  G: 21  C: 13

Fasta

 

>rirA E. coli K12. Version NC_000913.3 GI:556503834
tcaaagtaagtgcgttatcagtattcaggtagctgttgagcctggggcggtagcgtgctt
ttttctgcttaac
              
                            

Download fasta file
RegulonDB