RegulonDB RegulonDB 10.9: Gene Sequence
ysaC gene sequence


Size: 102        A: 29  T: 28  G: 25  C: 20

Fasta

 

>ysaC E. coli K12. Version NC_000913.3 GI:556503834
tttaatgacgttggctatttccggcagatttttcagaaacatactggtttaacgccagca
gcgtggaagcggcgttacagcaaggaacatatcaattcgtag
              
                            

Download fasta file
RegulonDB