RegulonDB RegulonDB 11.0: Gene Sequence
yrdF gene sequence


Size: 143        A: 46  T: 37  G: 30  C: 30

Fasta

 

>yrdF E. coli K12. Version NC_000913.3 GI:556503834
ttgaaatcattattcaatcggttaacgggaaaagcggttagccggacagctttcgtcgaa
caccttggtcaggaagttatacaacatcatccaaactggaaagtcatgatttcgactgac
cacaaattgatgcgcattgatac
              
                            

Download fasta file
RegulonDB