RegulonDB RegulonDB 11.0: Gene Sequence
gadF gene sequence


Size: 91        A: 19  T: 29  G: 20  C: 23

Fasta

 

>gadF E. coli K12. Version NC_000913.3 GI:556503834
ctttattcccctggtatgtgtatccaccagtagaacccttcgttgcccgaatgctggcag
gaactgttggcagaacggcaacatttttttt
              
                            

Download fasta file
RegulonDB