RegulonDB RegulonDB 10.8: Gene Sequence
rseD gene sequence


Size: 156        A: 47  T: 40  G: 37  C: 32

Fasta

 

>rseD E. coli K12. Version NC_000913.3 GI:556503834
atgatccgtctacagcatgacaaacaaaaacagatgcgttacggaactttacaaaaacga
gacactctaaccctttgcttgctcaaattgcagctaatggagtggcgtttcgatagcgcg
tggaaatttggtttggggagactttacctcggatga
              
                            

Download fasta file
RegulonDB