RegulonDB RegulonDB 10.8: Gene Sequence
yecC3' gene sequence


Size: 191        A: 40  T: 51  G: 52  C: 48

Fasta

 

>yecC3' E. coli K12. Version NC_000913.3 GI:556503834
tgttttttctggttcgatctggcttaacgccatttgttgagcgatgtcagaagcaatgta
acgctgccctgaatagacagaacgaatcgcactcacgacttcctgcggagccgcgccttt
gctgaggtagcccgcagcaccggcctgcatgactttcgctggtaaagggttttctgtatg
gacggtaagca
              
                            

Download fasta file
RegulonDB