RegulonDB RegulonDB 10.10: Gene Sequence
ybgU gene sequence


Size: 108        A: 36  T: 35  G: 24  C: 13

Fasta

 

>ybgU E. coli K12. Version NC_000913.3 GI:556503834
atgcgtaaaagttatgaagtcggtatttcacctaagattaacttatgtaacagtgtggaa
gtattgaccaattcattcgggacagttattagtggtagacaagtttaa
              
                            

Download fasta file
RegulonDB