RegulonDB RegulonDB 10.9: Gene Sequence
sdhX gene sequence


Size: 101        A: 21  T: 31  G: 26  C: 23

Fasta

 

>sdhX E. coli K12. Version NC_000913.3 GI:556503834
atatctgtaataagaaatagccctcgccgcttccctctacaggaatggcgaagggctgtc
ggtttcgacatggttggccatcgtatgatggccttttttgt
              
                            

Download fasta file
RegulonDB