RegulonDB RegulonDB 10.10: Gene Sequence
ybgV gene sequence


Size: 33        A: 11  T: 11  G: 8  C: 3

Fasta

 

>ybgV E. coli K12. Version NC_000913.3 GI:556503834
gtggtagacaagtttaataattcggattgctaa
              
                            

Download fasta file
RegulonDB