RegulonDB RegulonDB 10.10: Gene Sequence
ynaN gene sequence


Size: 48        A: 17  T: 10  G: 13  C: 8

Fasta

 

>ynaN E. coli K12. Version NC_000913.3 GI:556503834
atgttgcgtaacagggccagaaggctagactacaaaataatgcgttga
              
                            

Download fasta file
RegulonDB