RegulonDB RegulonDB 10.9: Gene Sequence
speFL gene sequence


Size: 105        A: 31  T: 29  G: 18  C: 27

Fasta

 

>speFL E. coli K12. Version NC_000913.3 GI:556503834
atggaaaataacagccgcactatgccccatataaggcggacaactcatattatgaagttt
gctcatcgcaatagcttcgactttcacttcttcaatgcccgttag
              
                            

Download fasta file
RegulonDB