RegulonDB RegulonDB 10.9: smallRNA Sequence
small regulatory RNA Spot 42 small RNA sequence


Size: 111        A: 25  U: 40  G: 26  C: 20

Fasta

 

>Spot42 E. coli K12. Version NC_000913.3 GI:556503834
UAGGGUACAGAGGUAAGAUGUUCUAUCUUUCAGACCUUUUACUUCACGUAAUCGGAUUUG
GCUGAAUAUUUUAGCCGCCCCAGUCAGUAAUGACUGGGGCGUUUUUUA
          
                        

Download fasta file
RegulonDB