RegulonDB RegulonDB 10.9: smallRNA Sequence
small regulatory RNA MicA small RNA sequence


Size: 73        A: 19  U: 23  G: 15  C: 16

Fasta

 

>MicA E. coli K12. Version NC_000913.3 GI:556503834
AAAGACGCGCAUUUGUUAUCAUCAUCCCUGAAUUCAGAGAUGAAAUUUUGGCCACUCACG
AGUGGCCUUUU
          
                        

Download fasta file
RegulonDB