RegulonDB RegulonDB 11.0: smallRNA Sequence
small regulatory RNA ChiX small RNA sequence


Size: 84        A: 28  U: 25  G: 15  C: 16

Fasta

 

>small regulatory RNA ChiX E. coli K12. Version NC_000913.3 GI:556503834
ACACCGUCGCUUAAAGUGACGGCAUAAUAAUAAAAAAAUGAAAUUCCUCUUUGACGGGCC
AAUAGCGAUAUUGGCCAUUUUUUU
          
                        

Download fasta file
RegulonDB