RegulonDB RegulonDB 10.9: smallRNA Sequence
small regulatory RNA FnrS small RNA sequence


Size: 122        A: 25  U: 43  G: 28  C: 26

Fasta

 

>FnrS E. coli K12. Version NC_000913.3 GI:556503834
CAGGUGAAUGCAACGUCAAGCGAUGGGCGUUGCGCUCCAUAUUGUCUUACUUCCUUUUUU
GAAUUACUGCAUAGCACAAUUGAUUCGUACGACGCCGACUUUGAUGAGUCGGCUUUUU
          
                        

Download fasta file
RegulonDB