RegulonDB RegulonDB 10.8: smallRNA Form
   

GcvB small RNA in Escherichia coli K-12 genome


Gene local context to scale (view description)

gcvA ygdI gcvB GcvA GcvA TSS_3119 TSS_3119 TSS_3118 TSS_3118 gcvBp gcvBp gcvAp gcvAp ygdDp2 ygdDp2
small RNA      
Gene name: gcvB    Texpresso search in the literature
Synonym(s): IS145, PsrA11, psrA11, small regulatory RNA GcvB
Genome position: 2942696 --> 2942900
Strand: forward
Sequence: Get ribonucleotide sequence FastaFormat
GC content %:  
42.93
Note(s): GcvB is a small RNA of approximately 205 nt in length Argaman L,2001. Although its expression appears to be regulated by the glycine cleavage system regulators GcvA and GcvR, GcvB itself is not involved in regulating components of the glycine cleavage system. Instead, GcvB regulates expression of the periplasmic transporter components DppA and OppA Urbanowski ML,2000, the serine/threonine transporter SstT 18952787, CycA, a transporter for certain amino acids Pulvermacher SC,2009, the transcription factors CsgD Jorgensen MG,2012 and Lrp 21876160. 27137887, and the PhoQ/PhoQ two-component system 23300478. Both OppA Urbanowski ML,2000 and DppA Urban JH,2007 expression is repressed by GcvB at the level of translation. Repression of SstT 18952787, CycA Pulvermacher SC,2009 and DppA/OppA 19118352 expression by GcvB requires Hfq. GcvB is unstable in an hfq mutant Urban JH,2007. 19118352.
Using a network biology approach, GcvB was predicted to be involved in the regulation of amino acid availability 21876160. GcvB-target interactions were investigated by RIL-seq Melamed S,2016. A screen using MS2-affinity purification coupled with RNA sequencing (MAPS) was used to identify additional targets of GcvB regulation Lalaouna D,2019. GcvB directly represses expression of the transcription factor Lrp 21876160. GcvB promotes mutagenic break repair 27698081.
Two transcripts, presumably due to two Rho-independent terminators, can be detected; transcriptional fusions indicate that the shorter, ~130 nt transcript predominates in vivo Urbanowski ML,2000, although the longer transcript predominated in a Northern blot experiment 27190161.
Mutagenesis of nucleotides predicted to be involved in binding to dppA and oppA mRNAs as well as compensatory mutations in the dppA and oppA UTRs showed mixed results, indicating that base pairing between GcvB and its targets is only part of its regulatory mechanism Pulvermacher SC,2008. A second predicted base pairing site within GcvB does not appear to be required for regulation of oppA expression 20603180.
The GcvB homolog of Salmonella enterica was shown to inhibit translation initiation by binding to the dppA and oppA mRNAs 17974919. There are more than 20 validated targets of GcvB in Salmonella enterica 21696468.
A gcvB mutant does not exhibit a defect in glycine cleavage system activity Urbanowski ML,2000. It overproduces OppA, DppA Urbanowski ML,2000, and Lrp 27137887 and is more sensitive to acid challenge than wild type 19379489. A ΔgcvB mutant also shows an increased σE-dependent membrane stress response and reduced σS-dependent general stress response 27698081. Overexpression of GcvB increases biofilm formation and decreases swarming motility Bak G,2015.
gcvB is expressed during early log phase, but its level decreases during cell growth Argaman L,2001; in LB, GcvB is produced from exponential through stationary phase, until ~OD600nm 3 Lalaouna D,2019. Expression is much higher in rich (LB) medium than in glucose minimal medium 27190161. Lalaouna D,2019. Transcription of gcvB is regulated by the GcvA activator and the GcvR repressor in response to glycine Urbanowski ML,2000. Expression of gcvB is lower in a phoP mutant than in wild type Raghavan R,2011. The |FRAME: RNA0-124| destabilizes GcvB and may act as a sponge 25630703. Lalaouna D,2019. Levels of SroC and GcvB during growth are dissimilar Lalaouna D,2019.
PsrA11: predicted small RNA Argaman L,2001
Reviews: 19366629. 25028968. Frohlich KS,2018
Evidence: [IDA] Inferred from direct assay
[IEP] Inferred from expression pattern
[IGI] Inferred from genetic interaction
[IMP] Inferred from mutant phenotype
Reference(s): [1] Andreassen PR., et al., 2018
[2] Argaman L., et al., 2001
[3] Baisa G., et al., 2013
[4] Busi F., et al., 2009
[5] Chen S., et al., 2002
[6] Harwani D., et al., 2012
[7] Kuryllo K., et al., 2014
[8] Lalaouna D., et al., 2019
[9] Melamed S., et al., 2016
[10] Pulvermacher SC., et al., 2008
[11] Pulvermacher SC., et al., 2009
[12] Urban JH., et al., 2007
[13] Urbanowski ML., et al., 2000
[14] Yang Q., et al., 2014
External database links:  
ECOCYC:
GCVB-RNA
ECOLIWIKI:
b4443
M3D: GcvB


Regulation exerted by the small RNA    
  Target Regulation Type Mechanism Function Binding Site Evidence
Code
Reference(s)
LeftPos RightPos Distance
to the gene
Sequence
 
unknown
unknown
repressor
 
 
 
 
 
 
unknown
unknown
repressor
 
 
 
 
 
 
antisense
transcriptional regulation
repressor
3707708
3707736
-17
AAACAACAAACATCACAATTGGAGCAGA
 
 
 
antisense
translational regulation
repressor
1301175
1301195
3
AAAACAATGACCAACATCAC
 
 
 
antisense
translational regulation
repressor
687791
687824
-60
AGTTGCAGACGATAACAACACAAACACTCACAA
 
 
 
antisense
translational regulation
repressor
3599680
3599703
-33
AACATCACAACACACGTAATAAC
 
 
 
antisense
translational regulation
repressor
3597577
3597600
-28
AAACAAAGCAACACAACATCACG
 
 
 
antisense
translational regulation
repressor
2427824
2427849
-45
TGCAAACACACAACACAATACACAA
 
 
 
antisense
post-transcriptional regulation
repressor
3239918
3239944
-13
GACAACACAATGAAAGGATCGAAAAA
 
 
 
antisense
post-transcriptional regulation
repressor
4429838
4429870
-10
CAGACAGGTACAGGAAGAAAAAAACATGGTAG
 
 
unknown
unknown
activator
 
 
 
 
 
 
unknown
unknown
activator
 
 
 
 
 
 
unknown
unknown
activator
 
 
 
 
 
 
unknown
unknown
activator
 
 
 
 
 
 
unknown
unknown
activator
 
 
 
 
 
 
unknown
unknown
activator
 
 
 
 
 
 
unknown
unknown
activator
 
 
 
 
 
 
unknown
unknown
activator
 
 
 
 
 
 
unknown
unknown
activator
 
 
 
 
 
 
unknown
unknown
activator
 
 
 
 
 
 
unknown
unknown
repressor
 
 
 
 
 
 
unknown
unknown
repressor
 
 
 
 
 
 
unknown
unknown
repressor
 
 
 
 
 
 
unknown
unknown
repressor
 
 
 
 
 
 
unknown
unknown
activator
 
 
 
 
 
 
unknown
unknown
repressor
 
 
 
 
 
 
unknown
unknown
repressor
 
 
 
 
 
 
unknown
unknown
activator
 
 
 
 
 
 
unknown
unknown
activator
 
 
 
 
 
 
unknown
unknown
repressor
 
 
 
 
 
 
unknown
unknown
repressor
 
 
 
 
 
 
unknown
unknown
repressor
 
 
 
 
 
 
unknown
unknown
repressor
 
 
 
 
 
 
unknown
unknown
repressor
 
 
 
 
 
 
unknown
unknown
activator
 
 
 
 
 
 
unknown
unknown
activator
 
 
 
 
 
 
unknown
unknown
activator
 
 
 
 
 
 
unknown
unknown
activator
 
 
 
 
 
 
unknown
unknown
activator
 
 
 
 
 
 
unknown
unknown
repressor
 
 
 
 
 
 
unknown
unknown
repressor
 
 
 
 
 
 
unknown
unknown
repressor
 
 
 
 
 
 
unknown
unknown
repressor
 
 
 
 
 
 
unknown
unknown
activator
 
 
 
 
 
 
unknown
unknown
repressor
 
 
 
 
 
 
unknown
unknown
repressor
 
 
 
 
 
 
unknown
unknown
repressor
 
 
 
 
 
 
unknown
unknown
repressor
 
 
 
 
 
 
unknown
unknown
repressor
 
 
 
 
 
 
unknown
unknown
repressor
 
 
 
 
 
 
unknown
unknown
repressor
 
 
 
 
 
 
unknown
unknown
repressor
 
 
 
 
 
 
unknown
unknown
repressor
 
 
 
 
 
 
unknown
unknown
repressor
 
 
 
 
 
 
unknown
unknown
repressor
 
 
 
 
 
 
unknown
unknown
repressor
 
 
 
 
 
 
unknown
unknown
repressor
 
 
 
 
 
 
unknown
unknown
repressor
 
 
 
 
 
 
unknown
unknown
repressor
 
 
 
 
 
Evidence: [IMP] Inferred from mutant phenotype


Reference(s)    

 [1] Andreassen PR., Pettersen JS., Szczerba M., Valentin-Hansen P., Moller-Jensen J., Jorgensen MG., 2018, sRNA-dependent control of curli biosynthesis in Escherichia coli: McaS directs endonucleolytic cleavage of csgD mRNA., Nucleic Acids Res 46(13):6746-6760

 [2] Argaman L., Hershberg R., Vogel J., Bejerano G., Wagner EG., Margalit H., Altuvia S., 2001, Novel small RNA-encoding genes in the intergenic regions of Escherichia coli., Curr Biol 11(12):941-50

 [3] Baisa G., Stabo NJ., Welch RA., 2013, Characterization of Escherichia coli D-Cycloserine Transport and Resistant Mutants., J Bacteriol 195(7):1389-99

 [4] Busi F., Cayrol B., Lavelle C., LeDerout J., Pietrement O., Le Cam E., Geinguenaud F., Lacoste J., Regnier P., Arluison V., 2009, Auto-assembly as a new regulatory mechanism of noncoding RNA., Cell Cycle 8(6):952-4

 [5] Chen S., Lesnik EA., Hall TA., Sampath R., Griffey RH., Ecker DJ., Blyn LB., 2002, A bioinformatics based approach to discover small RNA genes in the Escherichia coli genome., Biosystems 65(2-3):157-77

 [6] Harwani D., Zangoui P., Mahadevan S., 2012, The β-Glucoside (bgl) Operon of Escherichia coli Is Involved in the Regulation of oppA, Encoding an Oligopeptide Transporter., J Bacteriol 194(1):90-9

 [7] Kuryllo K., Jahanshahi S., Zhu W., Brown ED., Li Y., 2014, A dual reporter system for detecting RNA interactions in bacterial cells., Chembiochem 15(18):2703-9

 [8] Lalaouna D., Eyraud A., Devinck A., Prevost K., Masse E., 2019, GcvB small RNA uses two distinct seed regions to regulate an extensive targetome., Mol Microbiol 111(2):473-486

 [9] Melamed S., Peer A., Faigenbaum-Romm R., Gatt YE., Reiss N., Bar A., Altuvia Y., Argaman L., Margalit H., 2016, Global Mapping of Small RNA-Target Interactions in Bacteria., Mol Cell 63(5):884-97

 [10] Pulvermacher SC., Stauffer LT., Stauffer GV., 2008, The role of the small regulatory RNA GcvB in GcvB/mRNA posttranscriptional regulation of oppA and dppA in Escherichia coli., FEMS Microbiol Lett 281(1):42-50

 [11] Pulvermacher SC., Stauffer LT., Stauffer GV., 2009, Role of the sRNA GcvB in regulation of cycA in Escherichia coli., Microbiology 155(Pt 1):106-14

 [12] Urban JH., Vogel J., 2007, Translational control and target recognition by Escherichia coli small RNAs in vivo., Nucleic Acids Res 35(3):1018-37

 [13] Urbanowski ML., Stauffer LT., Stauffer GV., 2000, The gcvB gene encodes a small untranslated RNA involved in expression of the dipeptide and oligopeptide transport systems in Escherichia coli., Mol Microbiol 37(4):856-68

 [14] Yang Q., Figueroa-Bossi N., Bossi L., 2014, Translation enhancing ACA motifs and their silencing by a bacterial small regulatory RNA., PLoS Genet 10(1):e1004026


RegulonDB