RegulonDB RegulonDB 10.8: smallRNA Form
   

OmrA small RNA in Escherichia coli K-12 genome


Gene local context to scale (view description)

aas omrA omrB lplT OmpR anti-anti-terminator anti-terminator terminator omrBp omrBp omrAp omrAp TSS_3137 TSS_3137 TSS_3136 TSS_3136 lplTp3 lplTp3
small RNA      
Gene name: omrA    Texpresso search in the literature
Synonym(s): PAIR2, PAIR2a, PsrA12, RygA, SraE, T59, psrA12, rygA, small regulatory RNA OmrA, sraE, t59
Genome position: 2976102 <-- 2976189
Strand: reverse
Sequence: Get ribonucleotide sequence FastaFormat
GC content %:  
50.0
Note(s): OmrA is a small RNA of approximately 88 nt in length Argaman L,2001. Wassarman KM,2001 that is involved in regulating the protein composition of the outer membrane Guillier M,2006. OmrA was shown to negatively regulate the levels of ompT, cirA, fecA Guillier M,2006, fepA Guillier M,2006. 28918899, ompR Guillier M,2008. 27439713, csgD Holmqvist E,2010, flhDC 22925049, and dgcM 30833291 mRNAs. The effect of OmrA on ompT and cirA abundance is dependent on RNase E and involves direct base pairing at the 5' end of OmrA Guillier M,2008. OmrA affects DgcM translation by competing with the ribosome for binding to the dgcM mRNA that has been restructured by Hfq 30833291.
A set of targets for regulation by OmrA has been predicted, but only a small percentage of those possible targets was supported by microarray data 16717284. Binding site features for OmrA were identified by high-throughput in vivo mapping Mihailovic MK,2018.
OmrA represses its own synthesis via feedback regulation of its transcriptional activator OmpR 27439713.
Interaction between OmrA RNA and Hfq protein has been detected Wassarman KM,2001, and the effect of OmrA on ompT and cirA expression is dependent on Hfq Guillier M,2008.
OmrA and OmrB were first recognized as an intergenic duplication (PAIR2) containing sites that resemble Rho-independent terminators Rudd KE.,1999. The 5' and 3' ends of OmrA and OmrB are nearly identical, but their central regions differ.
OmrA is highly abundant in stationary phase cells grown in LB medium Argaman L,2001. Wassarman KM,2001. Zhang A,2003. The half life of OmrA in stationary phase is 16 minutes Vogel J,2003. Transcription of omrA is regulated by OmpR Guillier M,2006 and by σS Peano C,2015.
The 5' end of OmrA is required for the regulatory function of the small RNA Guillier M,2008. An omrAB deletion mutant shows a change in the protein composition of the outer membrane Guillier M,2006. Overexpression of omrA inhibits the formation of curli by downregulating CsgD expression Holmqvist E,2010.
Overexpression of OmrA decreases biofilm formation, swimming and swarming motility, and curli expression Bak G,2015.
Transcription of omrA is activated by OmpR Guillier M,2006. 27439713.
SraE: small RNA, PsrA12: predicted small RNA Argaman L,2001
Ryx: RNA of unknown function at X position (10 minute) in the genome Wassarman KM,2001
OmrA: OmpR-regulated sRNA A Guillier M,2006
Reviews: 17055775. 19366629. 25028968
Evidence: [IDA] Inferred from direct assay
[IMP] Inferred from mutant phenotype
Reference(s): [1] Argaman L., et al., 2001
[2] Guillier M., et al., 2006
[3] Guillier M., et al., 2008
[4] Holmqvist E., et al., 2010
[5] Moon K., et al., 2011
[6] Rivas E., et al., 2001
[7] Wassarman KM., et al., 2001
External database links:  
ECOCYC:
SRAE-RNA
ECOLIWIKI:
b4444
M3D: OmrA


Regulation exerted by the small RNA    
  Target Regulation Type Mechanism Function Binding Site Evidence
Code
Reference(s)
LeftPos RightPos Distance
to the gene
Sequence
 
antisense
post-transcriptional regulation
repressor
2246779
2246804
-22
ATTTTATTTTCGTAGTTACCTCATG
 
 
antisense
post-transcriptional regulation
repressor
 
 
 
 
 
 
antisense
post-transcriptional regulation
repressor
 
 
 
 
 
 
antisense
post-transcriptional regulation
repressor
585614
585645
4
TGGAGAACTTTTATGCGGGCGAAACTTCTGG
 
 
antisense
post-transcriptional regulation
repressor
 
 
 
 
 
 
 
antisense
post-transcriptional regulation
repressor
 
 
 
 
 
 
antisense
post-transcriptional regulation
repressor
 
 
 
 
 
 
antisense
post-transcriptional regulation
repressor
 
 
 
 
 
 
antisense
post-transcriptional regulation
repressor
 
 
 
 
 
 
antisense
post-transcriptional regulation
repressor
 
 
 
 
 
 
antisense
post-transcriptional regulation
repressor
 
 
 
 
 
 
antisense
post-transcriptional regulation
repressor
 
 
 
 
 
 
antisense
post-transcriptional regulation
repressor
 
 
 
 
 
 
antisense
post-transcriptional regulation
repressor
 
 
 
 
 
 
antisense
post-transcriptional regulation
repressor
 
 
 
 
 
 
antisense
post-transcriptional regulation
repressor
 
 
 
 
 
 
antisense
post-transcriptional regulation
repressor
 
 
 
 
 
 
antisense
post-transcriptional regulation
repressor
 
 
 
 
 
 
antisense
post-transcriptional regulation
repressor
 
 
 
 
 
 
antisense
post-transcriptional regulation
repressor
 
 
 
 
 
 
antisense
post-transcriptional regulation
activator
 
 
 
 
 
 
antisense
post-transcriptional regulation
activator
 
 
 
 
 
 
antisense
post-transcriptional regulation
activator
 
 
 
 
 
 
antisense
post-transcriptional regulation
activator
 
 
 
 
 
 
antisense
post-transcriptional regulation
activator
 
 
 
 
 
 
antisense
post-transcriptional regulation
activator
 
 
 
 
 
 
antisense
post-transcriptional regulation
repressor
3536595
3536613
-20
ATTGTTGCGAACCTTTGG
 
 
 
 
repressor
 
 
 
 
 
 
Evidence: [IMP] Inferred from mutant phenotype


Reference(s)    

 [1] Argaman L., Hershberg R., Vogel J., Bejerano G., Wagner EG., Margalit H., Altuvia S., 2001, Novel small RNA-encoding genes in the intergenic regions of Escherichia coli., Curr Biol 11(12):941-50

 [2] Guillier M., Gottesman S., 2006, Remodelling of the Escherichia coli outer membrane by two small regulatory RNAs., Mol Microbiol 59(1):231-47

 [3] Guillier M., Gottesman S., 2008, The 5' end of two redundant sRNAs is involved in the regulation of multiple targets, including their own regulator., Nucleic Acids Res 36(21):6781-94

 [4] Holmqvist E., Reimegard J., Sterk M., Grantcharova N., Romling U., Wagner EG., 2010, Two antisense RNAs target the transcriptional regulator CsgD to inhibit curli synthesis., EMBO J 29(11):1840-50

 [5] Moon K., Gottesman S., 2011, Competition among Hfq-binding small RNAs in Escherichia coli., Mol Microbiol 82(6):1545-62

 [6] Rivas E., Klein RJ., Jones TA., Eddy SR., 2001, Computational identification of noncoding RNAs in E. coli by comparative genomics., Curr Biol 11(17):1369-73

 [7] Wassarman KM., Repoila F., Rosenow C., Storz G., Gottesman S., 2001, Identification of novel small RNAs using comparative genomics and microarrays., Genes Dev 15(13):1637-51


RegulonDB