RegulonDB

RegulonDB RegulonDB 10.10: smallRNA Form

small regulatory RNA RybB small RNA in Escherichia coli K-12 genome

Gene local context to scale (view description)

small RNA
Gene name:	rybB
Synonym(s):	P25, RybB
Genome position:	887979 <-- 888057
Strand:	reverse
Sequence:	Get ribonucleotide sequence FastaFormat
GC content %:	48.1
Note(s):	RybB is a small regulatory RNA whose expression increases in stationary phase, when its half life is 8 minutes Wassarman KM,2001. Vogel J,2003. RybB expression is dependent on the alternative sigma factor σ^E, which is activated by cell envelope stress Johansen J,2006. Thompson KM,2007. Indirect repression of σ^E synthesis by RybB creates an autoregulatory loop Thompson KM,2007. An efficient interaction between RybB RNA and Hfq protein has been detected Wassarman KM,2001, and the specific contacts between RybB and Hfq have been probed using Salmonella components 22645344. RybB also interacts with the RNA chaperone ProQ. The RbsZ RNA was discovered in an RNA-RNA interactome screen, where RybB-RbsZ was the most abundant pair found on ProQ. RbsZ appears to act as a sponge that lowers the leves of RybB, while ProQ protects RybB against downregulation/degradation by Hfq and RNase III Melamed S,2020. A number of regulatory targets of RybB were identified Gogol EB,2011. Prediction of regulatory targets of RybB can be improved by considering accessible regions in both the sRNA and its target 22767260; comparative genomics was subsequently used to predict regulatory targets Wright PR,2013. A candidate RybB regulon was inferred by integrating information on experimentally supported targets and sRNA-mRNA interactions with transcription datasets 32487739. New targets were identified by an affinity purification method Lalaouna D,2015. This method also identified direct interactions of RybB with the 3' external transcribed spacer (ETS) sequence of a tRNA-encoding operon, \|FRAME: TU00512\|. In this context, the 3'ETS^leuZ is thought to function as a sponge that absorbs transcriptional noise while RybB expression is not induced Lalaouna D,2015. Translation of WaaR may be downregulated by RybB 22021036. Overexpression of rybB causes increased expression of rpoS in minimal media Wassarman KM,2001 and decreased levels of ompC, ompW Johansen J,2006, rpoE, and rybB itself Thompson KM,2007. Overexpression of either MicA or RybB rescues the growth and viability phenotypes of σ^E depletion Gogol EB,2011 and also leads to increased cell lysis in stationary phase 22251246. Overexpression of RybB decreases biofilm formation and expression of type I fimbriae Bak G,2015. A rybB deletion mutant is less sensitive to cell envelope stress than wild type Hobbs EC,2010, appears unable to establish long-term stationary phase Nagamitsu H,2013, and shows increased frequency of persister cell waking 31608580. Expression of rybB is induced in complex medium at stationary phase Wassarman KM,2001. Vogel J,2003. RybB accumulates in the absence of \|FRAME: CPLX0-3521\| 18203924. Proper regulation of rybB expression by σ^E is critical Nicoloff H,2017. The transcripts of many RybB targets are decreased after σ^E induction as expected Lacoux C,2020. The \|FRAME: RNA0-413\| acts as a sponge for RybB Adams PP,2021. Reviews: 12654996. 15487940. 17055775. Papenfort K, Vogel J,2009. De la Cruz MA,2010. Azam MS,2015. 26618164. Frohlich KS,2018. 32213244
Evidence:	[IEP] Inferred from expression pattern [IMP] Inferred from mutant phenotype
Reference(s):	[1] El-Mowafi SA., et al., 2014 [2] Gogol EB., et al., 2011 [3] Guo MS., et al., 2014 [4] Johansen J., et al., 2006 [5] Lalaouna D., et al., 2015 [6] Leiser OP., et al., 2012 [7] Malecka EM., et al., 2015 [8] Mihailovic MK., et al., 2018 [9] Serra DO., et al., 2016 [10] Thompson KM., et al., 2007 [11] Wassarman KM., et al., 2001
External database links:

ECOCYC:	RYBB-RNA
ECOLIWIKI:	b4417
M3D:	small regulatory RNA RybB

Regulation exerted by the small RNA

	Target	Mechanism	Function	Target Type	Binding Site			Evidence Code	Reference(s)
	Target	Mechanism	Function	Target Type	LeftPos	RightPos	Sequence	Evidence Code	Reference(s)
	sdhC	MRNA-DEGRADATION	repressor	Gene	755153	755164	AAGAACAGCAUG	[IEP] [SM]	[12]
	csgDEFG	nd	repressor	TU	1103278	1103285	GCACUGCU	[IEP] [SM]	[9]
	csgDEFG	nd	repressor	TU	1103278	1103285	GCACUGCU	[IEP] [SM]	[9]
	fadL	nd	repressor	TU	2461288	2461304	AUCAUUGAGGUUAUGGU	[IEP] [IMP] [IPI]	[2] [13]
	fiu	nd	repressor	TU	841601	841615	GCCACUGUUAAUCCC	[IEP] [SM]	[2]
	nmpC	nd	repressor	TU	576806	576834	GCCACUGUUAAUUUUUUCAUCGUGAGCCC	[SM]	[2]
	ompC	nd	repressor	TU	2312750	2312782	GUUAUUAACCCUCUGUUAUAUGCCUUUAUUUGC	[AH] [IEP] [IPI]	[4] [13]
	ompC	nd	repressor	TU	2312750	2312782	GUUAUUAACCCUCUGUUAUAUGCCUUUAUUUGC	[AH] [IEP] [IPI]	[4] [13]
	ompC	nd	repressor	TU	2312750	2312782	GUUAUUAACCCUCUGUUAUAUGCCUUUAUUUGC	[AH] [IEP] [IPI]	[4] [13]
	ompF	nd	repressor	TU	987018	987042	GCCACUGCCGUCAAUAAGUUCUGUC	[IEP] [IPI] [SM]	[2] [13]
	ompF	nd	repressor	TU	987018	987042	GCCACUGCCGUCAAUAAGUUCUGUC	[IEP] [IPI] [SM]	[2] [13]
	ompW	nd	repressor	TU	1314007	1314039	CGACGGAGCGGAUAUGAAAAAGUUAACAGUGGC	[AH] [IEP] [IPI]	[4] [13]
	rbsB	nd	repressor	Gene	3936196	3936213	GAUCGUCAAAGCGGUGGU	[SM]	[14]
	rluD	nd	repressor	Gene	2736007	2736026	GCCAUAUAUACUGCUUCUUC	[IEP] [SM]	[2]
	tsx	nd	repressor	TU	432020	432038	GCCACUGUUUGAAAAUCCC	[IEP] [IPI]	[2] [13]
	tsx	nd	repressor	TU	432020	432038	GCCACUGUUUGAAAAUCCC	[IEP] [IPI]	[2] [13]
	yifE	nd	activator	TU	nd	nd	nd	[IDA] [IEP] [IPI]	[13]

Evidence:

[IEP] Inferred from expression pattern
[SM] Site mutation
[IMP] Inferred from mutant phenotype
[IPI] Inferred from physical interaction
[AH] Author hypothesis
[IDA] Inferred from direct assay

Reference(s)
[1] El-Mowafi SA., Alumasa JN., Ades SE., Keiler KC., 2014, Cell-based assay to identify inhibitors of the Hfq-sRNA regulatory pathway., Antimicrob Agents Chemother 58(9):5500-9
[2] Gogol EB., Rhodius VA., Papenfort K., Vogel J., Gross CA., 2011, Small RNAs endow a transcriptional activator with essential repressor functions for single-tier control of a global stress regulon., Proc Natl Acad Sci U S A 108(31):12875-80
[3] Guo MS., Updegrove TB., Gogol EB., Shabalina SA., Gross CA., Storz G., 2014, MicL, a new σE-dependent sRNA, combats envelope stress by repressing synthesis of Lpp, the major outer membrane lipoprotein., Genes Dev 28(14):1620-34
[4] Johansen J., Rasmussen AA., Overgaard M., Valentin-Hansen P., 2006, Conserved small non-coding RNAs that belong to the sigmaE regulon: role in down-regulation of outer membrane proteins., J Mol Biol 364(1):1-8
[5] Lalaouna D., Masse E., 2015, Identification of sRNA interacting with a transcript of interest using MS2-affinity purification coupled with RNA sequencing (MAPS) technology., Genom Data 5:136-8
[6] Leiser OP., Charlson ES., Gerken H., Misra R., 2012, Reversal of the ΔdegP phenotypes by a novel rpoE allele of Escherichia coli., PLoS One 7(3):e33979
[7] Malecka EM., Strozecka J., Sobanska D., Olejniczak M., 2015, Structure of bacterial regulatory RNAs determines their performance in competition for the chaperone protein Hfq., Biochemistry 54(5):1157-70
[8] Mihailovic MK., Vazquez-Anderson J., Li Y., Fry V., Vimalathas P., Herrera D., Lease RA., Powell WB., Contreras LM., 2018, High-throughput in vivo mapping of RNA accessible interfaces to identify functional sRNA binding sites., Nat Commun 9(1):4084
[9] Serra DO., Mika F., Richter AM., Hengge R., 2016, The green tea polyphenol EGCG inhibits E. coli biofilm formation by impairing amyloid curli fibre assembly and downregulating the biofilm regulator CsgD via the σ(E) -dependent sRNA RybB., Mol Microbiol 101(1):136-51
[10] Thompson KM., Rhodius VA., Gottesman S., 2007, {sigma}E Regulates and Is Regulated by a Small RNA in Escherichia coli., J Bacteriol 189(11):4243-56
[11] Wassarman KM., Repoila F., Rosenow C., Storz G., Gottesman S., 2001, Identification of novel small RNAs using comparative genomics and microarrays., Genes Dev 15(13):1637-51
[12] Desnoyers G., Masse E., 2012, Noncanonical repression of translation initiation through small RNA recruitment of the RNA chaperone Hfq., Genes Dev 26(7):726-39
[13] Lalaouna D., Carrier MC., Semsey S., Brouard JS., Wang J., Wade JT., Masse E., 2015, A 3' external transcribed spacer in a tRNA transcript acts as a sponge for small RNAs to prevent transcriptional noise., Mol Cell 58(3):393-405
[14] Melamed S., Adams PP., Zhang A., Zhang H., Storz G., 2020, RNA-RNA Interactomes of ProQ and Hfq Reveal Overlapping and Competing Roles., Mol Cell 77(2):411-425.e7

RegulonDB

Contact us Funding Terms & conditions How to cite