RegulonDB RegulonDB 10.8: smallRNA Form
   

OmrB small RNA in Escherichia coli K-12 genome


Gene local context to scale (view description)

galR omrA omrB GalS GalR OmpR OmpR anti-anti-terminator anti-terminator terminator anti-anti-terminator anti-terminator terminator TSS_3139 TSS_3139 galRp galRp omrBp omrBp omrAp omrAp
small RNA      
Gene name: omrB    Texpresso search in the literature
Synonym(s): PAIR2, PAIR2b, RygB, T59, rygB, small regulatory RNA OmrB, sraE, t59
Genome position: 2976304 <-- 2976385
Strand: reverse
Sequence: Get ribonucleotide sequence FastaFormat
GC content %:  
47.56
Note(s): OmrB is a small RNA that is involved in regulating the protein composition of the outer membrane Guillier M,2006. OmrB was shown to negatively regulate the levels of ompT, cirA, fecA Guillier M,2006, gntP 16717284, ompR Guillier M,2008. 27439713, csgD Holmqvist E,2010, flhDC 22925049, and dgcM 30833291 mRNAs. The effect of OmrB on ompT and cirA abundance is dependent on RNase E and involves direct base pairing at the 5' end of OmrB Guillier M,2008. OmrB affects DgcM translation by competing with the ribosome for binding to the dgcM mRNA that has been restructured by Hfq 30833291.
A set of targets for regulation by OmrB has been predicted, but only a small percentage of those possible targets was supported by microarray data 16717284. Binding site features for OmrA were identified by high-throughput in vivo mapping Mihailovic MK,2018.
OmrB represses its own synthesis via feedback regulation of its transcriptional activator OmpR 27439713.
Interaction between OmrB RNA and Hfq protein has been detected Wassarman KM,2001, and the effect of OmrB on ompT and cirA expression is dependent on Hfq Guillier M,2008.
OmrA and OmrB were first recognized as an intergenic duplication (PAIR2) containing sites that resemble Rho-independent terminators Rudd KE.,1999. The 5' and 3' ends of OmrA and OmrB are nearly identical, but their central regions differ.
OmrB levels increase at the end of exponential phase and decrease after the onset of stationary phase Vogel J,2003. The half life of OmrB in both exponential and stationary phase is 30 minutes Vogel J,2003. Transcription of omrB is regulated by OmpR Guillier M,2006.
The 5' end of OmrB is required for the regulatory function of the small RNA Guillier M,2008. An omrAB deletion mutant shows a change in the protein composition of the outer membrane Guillier M,2006. Overexpression of omrB inhibits the formation of curli by downregulating CsgD expression Holmqvist E,2010. Bak G,2015.
Transcription of omrB is activated by OmpR Guillier M,2006. 27439713.
Ryx: RNA of unknown function at X position (10 minute) in the genome Wassarman KM,2001
OmrB: OmpR-regulated sRNA B Guillier M,2006
Reviews: 17055775. 19366629. 25028968
Evidence: [IDA] Inferred from direct assay
[IMP] Inferred from mutant phenotype
Reference(s): [1] Guillier M., et al., 2006
[2] Guillier M., et al., 2008
[3] Vogel J., et al., 2003
External database links:  
ECOCYC:
RYGB-RNA
ECOLIWIKI:
b4445
M3D: OmrB


Regulation exerted by the small RNA    
  Target Regulation Type Mechanism Function Binding Site Evidence
Code
Reference(s)
LeftPos RightPos Distance
to the gene
Sequence
 
antisense
post-transcriptional regulation
repressor
2246779
2246804
-22
ATTTTATTTTCGTAGTTACCTCATG
 
 
antisense
post-transcriptional regulation
repressor
 
 
 
 
 
 
antisense
post-transcriptional regulation
repressor
585614
585645
4
TGGAGAACTTTTATGCGGGCGAAACTTCTGG
 
 
antisense
post-transcriptional regulation
repressor
 
 
 
 
 
 
 
antisense
post-transcriptional regulation
repressor
 
 
 
 
 
 
antisense
post-transcriptional regulation
repressor
 
 
 
 
 
 
antisense
post-transcriptional regulation
repressor
 
 
 
 
 
 
antisense
post-transcriptional regulation
repressor
 
 
 
 
 
 
antisense
post-transcriptional regulation
repressor
 
 
 
 
 
 
antisense
post-transcriptional regulation
repressor
 
 
 
 
 
 
antisense
post-transcriptional regulation
repressor
 
 
 
 
 
 
antisense
post-transcriptional regulation
repressor
 
 
 
 
 
 
antisense
post-transcriptional regulation
repressor
 
 
 
 
 
 
antisense
post-transcriptional regulation
repressor
 
 
 
 
 
 
antisense
post-transcriptional regulation
repressor
 
 
 
 
 
 
antisense
post-transcriptional regulation
repressor
 
 
 
 
 
 
antisense
post-transcriptional regulation
repressor
 
 
 
 
 
 
antisense
post-transcriptional regulation
repressor
 
 
 
 
 
 
antisense
post-transcriptional regulation
activator
 
 
 
 
 
 
antisense
post-transcriptional regulation
activator
 
 
 
 
 
 
antisense
post-transcriptional regulation
activator
 
 
 
 
 
 
antisense
post-transcriptional regulation
activator
 
 
 
 
 
 
antisense
post-transcriptional regulation
activator
 
 
 
 
 
 
antisense
post-transcriptional regulation
activator
 
 
 
 
 
 
antisense
post-transcriptional regulation
repressor
3536595
3536613
-20
ATTGTTGCGAACCTTTGG
 
 
 
 
repressor
 
 
 
 
 
 
Evidence: [IMP] Inferred from mutant phenotype


Reference(s)    

 [1] Guillier M., Gottesman S., 2006, Remodelling of the Escherichia coli outer membrane by two small regulatory RNAs., Mol Microbiol 59(1):231-47

 [2] Guillier M., Gottesman S., 2008, The 5' end of two redundant sRNAs is involved in the regulation of multiple targets, including their own regulator., Nucleic Acids Res 36(21):6781-94

 [3] Vogel J., Bartels V., Tang TH., Churakov G., Slagter-Jager JG., Huttenhofer A., Wagner EG., 2003, RNomics in Escherichia coli detects new sRNA species and indicates parallel transcriptional output in bacteria., Nucleic Acids Res 31(22):6435-43


RegulonDB