RegulonDB RegulonDB 11.0: smallRNA Form
   

small regulatory RNA OmrB small RNA in Escherichia coli K-12 genome


Gene local context to scale (view description)

galR omrA omrB GalS GalR OmpR OmpR anti-anti-terminator anti-terminator terminator anti-anti-terminator anti-terminator terminator TSS_3139 TSS_3139 galRp galRp omrBp omrBp omrAp omrAp
small RNA      
Gene name: omrB    Texpresso search in the literature
Synonym(s): OmrB, PAIR2b, RygB, T59
Genome position: 2976304 <-- 2976385
Strand: reverse
Sequence: Get ribonucleotide sequence FastaFormat
GC content %:  
47.56
Note(s): OmrB is a small RNA that is involved in regulating the protein composition of the outer membrane Guillier M,2006. OmrB was shown to negatively regulate the levels of ompT, cirA, fecA Guillier M,2006, gntP 16717284, ompR Guillier M,2008. 27439713, csgD Holmqvist E,2010, flhDC De Lay N,2012, dgcM Hoekzema M,2019, and flgM Romilly C,2020 mRNAs. The effect of OmrB on ompT and cirA abundance is dependent on RNase E and involves direct base pairing at the 5' end of OmrB Guillier M,2008. OmrB affects DgcM translation by competing with the ribosome for binding to the dgcM mRNA that has been restructured by Hfq Hoekzema M,2019.
A set of targets for regulation by OmrB has been predicted, but only a small percentage of those possible targets was supported by microarray data 16717284. Binding site features for OmrA were identified by high-throughput in vivo mapping Mihailovic MK,2018.
OmrB represses its own synthesis via feedback regulation of its transcriptional activator OmpR 27439713.
Interaction between OmrB RNA and Hfq protein has been detected Wassarman KM,2001, and the effect of OmrB on ompT and cirA expression is dependent on Hfq Guillier M,2008.
OmrA and OmrB were first recognized as an intergenic duplication (PAIR2) containing sites that resemble Rho-independent terminators Rudd KE.,1999. The 5' and 3' ends of OmrA and OmrB are nearly identical, but their central regions differ.
OmrB levels increase at the end of exponential phase and decrease after the onset of stationary phase Vogel J,2003. The half life of OmrB in both exponential and stationary phase is 30 minutes Vogel J,2003. Transcription of omrB is regulated by OmpR Guillier M,2006.
The 5' end of OmrB is required for the regulatory function of the small RNA Guillier M,2008. An omrAB deletion mutant shows a change in the protein composition of the outer membrane Guillier M,2006. Overexpression of omrB inhibits the formation of curli by downregulating CsgD expression Holmqvist E,2010. Bak G,2015.
Transcription of omrB is activated by OmpR Guillier M,2006. 27439713.
Ryx: RNA of unknown function at X position (10 minute) in the genome Wassarman KM,2001
OmrB: OmpR-regulated sRNA B Guillier M,2006
Reviews: Vogel J, Papenfort K,2006. Papenfort K, Vogel J,2009. 25028968. 32213244
Evidence: [IMP] Inferred from mutant phenotype
Reference(s): [1] Guillier M., et al., 2006
[2] Guillier M., et al., 2008
External database links:  
ECOCYC:
RYGB-RNA
ECOLIWIKI:
b4445
M3D: small regulatory RNA OmrB


Regulation exerted by the small RNA    
  Target Mechanism Function Target Type Binding Site Evidence
Code
Reference(s)
LeftPos RightPos Sequence
 
MRNA-DEGRADATION
repressor
TU
2246779
2246804
CCAUGAGGUAACUACGAAAAUAAAAU
[2]
 
MRNA-DEGRADATION
repressor
TU
2246779
2246804
CCAUGAGGUAACUACGAAAAUAAAAU
[2]
 
MRNA-DEGRADATION
repressor
TU
585614
585645
CCCAGAAGUUUCGCCCGCAUAAAAGUUCUCCA
[2]
 
TRANSLATION-BLOCKING
repressor
TU
1103257
1103275
CCAGAAGUACUGACAGAUG
[3]
 
TRANSLATION-BLOCKING
repressor
TU
1103257
1103275
CCAGAAGUACUGACAGAUG
[3]
 
TRANSLATION-BLOCKING
repressor
Gene
612451
612472
CCCAGAUUGACCAACAAGGCCA
 
TRANSLATION-BLOCKING
repressor
Gene
1130102
1130126
CAGAGGCGAAGUGCGAUCAAUACUC
[5]
 
TRANSLATION-BLOCKING
repressor
TU
1407768
1407779
CCAGGGUAUUGA
[6]
 
nd
repressor
TU
1978206
1978251
CCCAGAAUAACCAACUUUAUUUUUAUGCGGUUUCACCGCACCCCGU
[7]
 
nd
repressor
Gene
3536595
3536613
CCCAAAGGUUCGCAACAAU
[2]
Evidence: [SM] Site mutation
[IDA] Inferred from direct assay
[IEP] Inferred from expression pattern
[IPI] Inferred from physical interaction
[IMP] Inferred from mutant phenotype


Reference(s)    

 [1] Guillier M., Gottesman S., 2006, Remodelling of the Escherichia coli outer membrane by two small regulatory RNAs., Mol Microbiol 59(1):231-47

 [2] Guillier M., Gottesman S., 2008, The 5' end of two redundant sRNAs is involved in the regulation of multiple targets, including their own regulator., Nucleic Acids Res 36(21):6781-94

 [3] Holmqvist E., Reimegard J., Sterk M., Grantcharova N., Romling U., Wagner EG., 2010, Two antisense RNAs target the transcriptional regulator CsgD to inhibit curli synthesis., EMBO J 29(11):1840-50

 [4] Jagodnik J., Chiaruttini C., Guillier M., 2017, Stem-Loop Structures within mRNA Coding Sequences Activate Translation Initiation and Mediate Control by Small Regulatory RNAs., Mol Cell 68(1):158-170.e3

 [5] Romilly C., Hoekzema M., Holmqvist E., Wagner EGH., 2020, Small RNAs OmrA and OmrB promote class III flagellar gene expression by inhibiting the synthesis of anti-Sigma factor FlgM., RNA Biol 17(6):872-880

 [6] Hoekzema M., Romilly C., Holmqvist E., Wagner EGH., 2019, Hfq-dependent mRNA unfolding promotes sRNA-based inhibition of translation., EMBO J 38(7)

 [7] De Lay N., Gottesman S., 2012, A complex network of small non-coding RNAs regulate motility in Escherichia coli., Mol Microbiol 86(3):524-38


RegulonDB