RegulonDB RegulonDB 10.10: smallRNA Form
   

e14 prophage; small regulatory RNA C0293 small RNA in Escherichia coli K-12 genome


Gene local context to scale (view description)

icd ymfD C0293 TSS_1490 TSS_1490 TSS_1489 TSS_1489 TSS_1488 TSS_1488 TSS_1487 TSS_1487 TSS_1486 (cluster) TSS_1486 (cluster)
small RNA      
Gene name: C0293    Texpresso search in the literature
Synonym(s): C0293
Genome position: 1196711 --> 1196782
Strand: forward
Sequence: Get ribonucleotide sequence FastaFormat
GC content %:  
58.33
Note(s): The small regulatory RNA C0293 downregulates the expression of the transcription factors HcaR and FadR Madikonda AK,2020.
C0293 was first identified as a candidate small RNA locus of approximately 72 nt in length Tjaden B,2002.
Endogenously produced or externally added propionate represses expression of the C0293 RNA Madikonda AK,2020.
Review: 12654996
Evidence: [IMP] Inferred from mutant phenotype
Reference(s): [1] Madikonda AK., et al., 2020
External database links:  
ECOCYC:
RNA0-409
M3D: e14 prophage; small regulatory RNA C0293


Regulation exerted by the small RNA    
  Target Mechanism Function Target Type Binding Site Evidence
Code
Reference(s)
LeftPos RightPos Sequence
 
nd
repressor
Gene
1234958
1234981
CCCGGCGGGUUUCGCGGAAGAGUA
[1]
 
nd
repressor
TU
2668895
2668902
AUCACCUU
[1]
Evidence: [IEP] Inferred from expression pattern
[SM] Site mutation


Reference(s)    

 [1] Madikonda AK., Shaikh A., Khanra S., Yakkala H., Yellaboina S., Lin-Chao S., Siddavattam D., 2020, Metabolic remodeling in Escherichia coli MG1655. A prophage e14-encoded small RNA, co293, post-transcriptionally regulates transcription factors HcaR and FadR., FEBS J 287(21):4767-4782


RegulonDB