RegulonDB RegulonDB 10.8: Operon Form
   

ptsG operon and associated TUs in Escherichia coli K-12 genome




Operon      
Name: ptsG
This page displays every known transcription unit of this operon and their known regulation.


Transcription unit          
Name: ptsG
Gene(s): ptsG   Genome Browser M3D Gene expression COLOMBOS
Note(s): The ptsG gene appears to be regulated by FNR, but Shalel-Levanon et al. Shalel-Levanon S,2005reported a positive effect and Salmon et al. Shalel-Levanon S,2005reported a negative effect of this regulation; none of them reported which of the two promoters (ptsGp1 or ptsGp2) is affected, even is not known if this regulation is direct or indirect. On the other hand, under nitrogen-rich growth conditions, the expression of the ptsG gene was increased in mutants for two genes that encode two terminal oxidases, cyoA and cydB, and in mutants for two transcriptional regulators, Fnr and Fur Kumar R,2011
ptsG expression is under heat shock stress conditions Shin D,2001
Expression of ptsG is increased severalfold during cell growth on glucose or other PTS substrates 18402772 ptsG is regulated posttranscriptionally by modulation of mRNA stability in response to glycolytic flux 11432845and to the availability of oxygen 18402772 On the other hand, accumulation of glucose-6-phosphate induces expression of the SgrS small RNA and, subsequently, possible base paring with the 5'-UTR of the ptsG mRNA accelerates RNase E-dependent degradation of the ptsG transcript 11432845. Vanderpool CK,2004
The expression of the gene ptsG is increased under acidic growth conditions in aerobiosis but not in microaerobiosis Marzan LW,2013
Evidence: [BTEI] Boundaries of transcription experimentally identified
Reference(s): [1] Plumbridge J. 1998
Promoter
Name: ptsGp2
+1: 1157626
Sigma Factor: Sigma70 Sigmulon
Distance from start of the gene: 243
Sequence: atccgttgaatgagtttttttaaagctcgtaattaatggctaaaacgagtaaagttcaccGccgaaaattgggcggtgaat
                                                  -10       +1                   
Note(s): A third promoter in the region located between ptsGp1 and ptsGp2 was identified by in vitro transcription and by RNA polymerase footprinting techniques, as well as in vivo by S1 analysis and fusions with a lacZ reporter gene 20668389 It expresses a transcript antisense to ptsG that has characteristics more like a divergently expressed cryptic unstable transcript (CUT) than a prokaryotic sRNA 20668389
ptsGp2 was validated experimentally in aerobic conditions Chung D,2013.
Evidence: [HIPP]
[TIM]
Reference(s): [1] Plumbridge J. 1998
TF binding sites (TFBSs)
[Fis,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal Fis repressor ptsGp2 1157614 1157628 -5.0 gctaaaacgaGTAAAGTTCACCGCCgaaaattggg nd [BPP], [GEA] [3]
proximal Fis repressor ptsGp2 1157640 1157654 22.0 aaaattgggcGGTGAATAACCACGTttgaaatatt nd [BPP], [GEA] [3]
remote Fis repressor ptsGp2 1157679 1157693 61.0 catatgttttGTCAAAATGTGCAACttctccaatg nd [BPP], [GEA] [3]
remote Fis4 repressor ptsGp2 1157740 1157754 122.0 caaacaaattGGCACTGAATTATTTtactctgtgt nd [BPP], [GEA] [3]
remote Fis5 repressor ptsGp2 1157761 1157775 143.0 attttactctGTGTAATAAATAAAGggcgcttaga nd [BPP], [GEA] [3]
[Mlc,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal Mlc1 repressor ptsGp2 1157580 1157602 -35.0 gttgaatgagTTTTTTTAAAGCTCGTAATTAATggctaaaacg nd [APIORCISFBSCS], [BPP], [CV(CHIP-SV/GEA/ROMA)], [CV(GEA/ROMA)], [GEA] [1], [2]
Note(s): 4Fis binding to site I and II can coactivate ptsGp1 transcription with CRP.
5Fis binding to site I and II can coactivate ptsGp1 transcription with CRP.1The DgsA transcriptional repressor is inactivated by the cytoplasmic protein MtfA via a protein-protein interaction that prevents interaction of DgsA with its binding sites on the ptsG upstream region Gohler AK,20121The DgsA transcriptional repressor is inactivated by the cytoplasmic protein MtfA via a protein-protein interaction that prevents interaction of DgsA with its binding sites on the ptsG upstream region Gohler AK,2012
5Fis binding to site I and II can coactivate ptsGp1 transcription with CRP.
6Fis binding to site I and II can coactivate ptsGp1 transcription with CRP.


Transcription unit          
Name: ptsG
Gene(s): ptsG   Genome Browser M3D Gene expression COLOMBOS
Note(s): The ptsG gene appears to be regulated by FNR, but Shalel-Levanon et al. Shalel-Levanon S,2005reported a positive effect and Salmon et al. Shalel-Levanon S,2005reported a negative effect of this regulation; none of them reported which of the two promoters (ptsGp1 or ptsGp2) is affected, even is not known if this regulation is direct or indirect. On the other hand, under nitrogen-rich growth conditions, the expression of the ptsG gene was increased in mutants for two genes that encode two terminal oxidases, cyoA and cydB, and in mutants for two transcriptional regulators, Fnr and Fur Kumar R,2011
ptsG expression is under heat shock stress conditions Shin D,2001
Expression of ptsG is increased severalfold during cell growth on glucose or other PTS substrates 18402772 ptsG is regulated posttranscriptionally by modulation of mRNA stability in response to glycolytic flux 11432845and to the availability of oxygen 18402772 On the other hand, accumulation of glucose-6-phosphate induces expression of the SgrS small RNA and, subsequently, possible base paring with the 5'-UTR of the ptsG mRNA accelerates RNase E-dependent degradation of the ptsG transcript 11432845. Vanderpool CK,2004
The expression of the ptsG gene is increased under acidic growth conditions in aerobiosis but not in microaerobiosis Marzan LW,2013
The plasticity of the promoter regions was demonstrated for two CRP target genes, ptsG and manX . Four genetically different strains with the crp gene deleted were propagated in a glucose minimal medium. This deletion led to deleterious effects on growth in the four strains, but most of the populations quickly evolved compensatory changes that restored fast growth and were specific to the glucose environment in which they evolved. The adaptation involved plasticity of the promoter regions of two CRP target genes involved in glucose transport, ptsG and manX 30825312
Evidence: [BTEI] Boundaries of transcription experimentally identified
Reference(s): [1] Plumbridge J. 1998
Promoter
Name: ptsGp1
+1: 1157766
Distance from start of the gene: 103
Sequence: ctgaagttgaaacgtgatagccgtcaaacaaattggcactgaattattttactctgtgtaAtaaataaagggcgcttagat
Note(s): ~90% of the ptsG mRNA is transcribed from a major promoter, P1 (ptsGp1) Plumbridge J.,1998
A third promoter in the region located between ptsGp1 and ptsGp2 was identified by in vitro transcription and by RNA polymerase footprinting techniques, as well as in vivo by S1 analysis and fusions with a lacZ reporter gene 20668389 It expresses a transcript antisense to ptsG that has characteristics more like a divergently expressed cryptic unstable transcript (CUT) than a prokaryotic sRNA 20668389
ptsGp1 was validated experimentally in aerobic conditions Chung D,2013.
Evidence: [CV(RS-EPT-CBR/TA)]
[CV(TA/TIM)]
[RS-EPT-CBR]
[TIM]
Reference(s): [1] Plumbridge J. 1998
[4] Rungrassamee W., et al., 2008
[5] Salgado H, et al., 2012
TF binding sites (TFBSs)
[ArcA,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal ArcA-Phosphorylated1 repressor ptsGp1 1157674 1157688 -85.0 tgtgacatatGTTTTGTCAAAATGTgcaacttctc nd [BPP], [GEA] [6]
proximal ArcA-Phosphorylated2 repressor ptsGp1 1157711 1157725 -48.0 atgatctgaaGTTGAAACGTGATAGccgtcaaaca nd [BPP], [GEA] [6]
proximal ArcA-Phosphorylated repressor ptsGp1 1157760 1157774 2.0 tattttactcTGTGTAATAAATAAAgggcgcttag nd [BPP], [GEA] [6]
[CRP,+] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
remote CRP-cAMP activator ptsGp1 1157661 1157682 -94.5 acgtttgaaaTATTGTGACATATGTTTTGTCAaaatgtgcaa nd [BPP], [GEA] [3]
proximal CRP-cAMP activator ptsGp1 1157715 1157736 -40.5 tctgaagttgAAACGTGATAGCCGTCAAACAAattggcactg nd [AIBSCS], [BPP], [CV(CHIP-SV/GEA/ROMA)], [CV(GEA/ROMA)], [GEA] [1], [7]
[Fis,+] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal Fis1 activator ptsGp1 1157740 1157754 -19.0 caaacaaattGGCACTGAATTATTTtactctgtgt nd [BPP], [GEA] [3]
proximal Fis2 activator ptsGp1 1157761 1157775 3.0 attttactctGTGTAATAAATAAAGggcgcttaga nd [BPP], [GEA] [3]
[Fis,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
remote Fis repressor ptsGp1 1157614 1157628 -145.0 gctaaaacgaGTAAAGTTCACCGCCgaaaattggg nd [BPP], [GEA] [3]
remote Fis repressor ptsGp1 1157640 1157654 -119.0 aaaattgggcGGTGAATAACCACGTttgaaatatt nd [BPP], [GEA] [3]
proximal Fis repressor ptsGp1 1157679 1157693 -80.0 catatgttttGTCAAAATGTGCAACttctccaatg nd [BPP], [GEA] [3]
proximal Fis4 repressor ptsGp1 1157740 1157754 -19.0 caaacaaattGGCACTGAATTATTTtactctgtgt nd [BPP], [GEA] [3]
proximal Fis5 repressor ptsGp1 1157761 1157775 3.0 attttactctGTGTAATAAATAAAGggcgcttaga nd [BPP], [GEA] [3]
[Mlc,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal Mlc1 repressor ptsGp1 1157749 1157771 -6.0 tggcactgaaTTATTTTACTCTGTGTAATAAATaaagggcgct nd [APIORCISFBSCS], [BPP], [CV(CHIP-SV/GEA/ROMA)], [CV(GEA/ROMA)], [GEA] [1], [2], [3]
[SoxS,+] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal SoxS activator ptsGp1 1157673 1157693 -83.5 ttgtgacataTGTTTTGTCAAAATGTGCAACttctccaatg nd [APIORCISFBSCS], [BPP], [CV(CHIP-SV/GEA/ROMA)], [CV(GEA/ROMA)], [GEA] [4]
Note(s): 1The addition of CRP decreased the ArcA-specific protection on binding sites -48 and -85 and the CRP specific protection was decreased, implying that ArcA and CRP compete with each other for binding to the ptsGp1 promoter.
2The addition of CRP decreased the ArcA-specific protection on binding sites -48 and -85 and the CRP-specific protection was decreased, implying that ArcA and CRP compete with each other for binding to the ptsGp1 promoter.
1Fis binding to site I and II can coactivate ptsGp1 transcription with CRP.
2Fis binding to site I and II can coactivate ptsGp1 transcription with CRP.4Fis binding to site I and II can coactivate ptsGp1 transcription with CRP.
5Fis binding to site I and II can coactivate ptsGp1 transcription with CRP.1Mlc showed better repression of ptsGp1 in the presence of Fis.
The DgsA transcriptional repressor is inactivated by the cytoplasmic protein MtfA via a protein-protein interaction that prevents interaction of DgsA with its binding sites on the ptsG upstream region Gohler AK,20124The addition of CRP decreased the ArcA-specific protection on binding sites -48 and -85 and the CRP specific protection was decreased, implying that ArcA and CRP compete with each other for binding to the ptsGp1 promoter.
7The addition of CRP decreased the ArcA-specific protection on binding sites -48 and -85 and the CRP-specific protection was decreased, implying that ArcA and CRP compete with each other for binding to the ptsGp1 promoter.
9Fis binding to site I and II can coactivate ptsGp1 transcription with CRP.
10Fis binding to site I and II can coactivate ptsGp1 transcription with CRP.
11Mlc showed better repression of ptsGp1 in the presence of Fis.
The DgsA transcriptional repressor is inactivated by the cytoplasmic protein MtfA via a protein-protein interaction that prevents interaction of DgsA with its binding sites on the ptsG upstream region Gohler AK,2012
13Fis binding to site I and II can coactivate ptsGp1 transcription with CRP.
14Fis binding to site I and II can coactivate ptsGp1 transcription with CRP.


Regulation by sRNA    
  Small RNA name (Regulator) Regulation type Mechanism Function Binding Sites Evidence Reference
LeftPos RightPos Sequence (RNA-strand)
  sgrS antisense post-transcriptional regulation repressor 1157840 1157872 GCACCCATACTCAGGAGCACTCTCAATTATGT
Notes: "The provided sequence is that of the RNA strand,i.e. 'U's are showed instead the 'T'"


Evidence    

 [HIPP] Human inference of promoter position

 [TIM] Transcription initiation mapping

 [BPP] Binding of purified proteins

 [GEA] Gene expression analysis

 [APIORCISFBSCS] A person inferred or reviewed a computer inference of sequence function based on similarity to a consensus sequence.

 [CV(CHIP-SV/GEA/ROMA)] cross validation(CHIP-SV/GEA/ROMA)

 [CV(GEA/ROMA)] cross validation(GEA/ROMA)

 [CV(RS-EPT-CBR/TA)] cross validation(RS-EPT-CBR/TA)

 [CV(TA/TIM)] cross validation(TA/TIM)

 [RS-EPT-CBR] RNA-seq using two enrichment strategies for primary transcripts and consistent biological replicates

 [AIBSCS] Automated inference based on similarity to consensus sequences


Reference(s)    

 [1] Plumbridge J., 1998, Expression of ptsG, the gene for the major glucose PTS transporter in Escherichia coli, is repressed by Mlc and induced by growth on glucose., Mol Microbiol 29(4):1053-63

 [2] Plumbridge J., 2001, DNA binding sites for the Mlc and NagC proteins: regulation of nagE, encoding the N-acetylglucosamine-specific transporter in Escherichia coli., Nucleic Acids Res 29(2):506-14

 [3] Shin D., Cho N., Heu S., Ryu S., 2003, Selective regulation of ptsG expression by Fis. Formation of either activating or repressing nucleoprotein complex in response to glucose., J Biol Chem 278(17):14776-81

 [4] Rungrassamee W., Liu X., Pomposiello PJ., 2008, Activation of glucose transport under oxidative stress in Escherichia coli., Arch Microbiol 190(1):41-9

 [5] Salgado H, Peralta-Gil M, Gama-Castro S, Santos-Zavaleta A, Muñiz-Rascado L, García-Sotelo JS, Weiss V, Solano-Lira H, Martínez-Flores I, Medina-Rivera A, Salgado-Osorio G, Alquicira-Hernández S, Alquicira-Hernández K, López-Fuentes A, Porrón-Sotelo L, Huerta AM, Bonavides-Martínez C, Balderas-Martínez YI, Pannier L, Olvera M, Labastida A, Jiménez-Jacinto V, Vega-Alvarado L, Del Moral-Chávez V, Hernández-Alvarez A, Morett E, Collado-Vides J., 2012, RegulonDB v8.0: omics data sets, evolutionary conservation, regulatory phrases, cross-validated gold standards and more., Nucleic Acids Res.

 [6] Jeong JY., Kim YJ., Cho N., Shin D., Nam TW., Ryu S., Seok YJ., 2004, Expression of ptsG Encoding the Major Glucose Transporter Is Regulated by ArcA in Escherichia coli., J Biol Chem 279(37):38513-8

 [7] Zheng D., Constantinidou C., Hobman JL., Minchin SD., 2004, Identification of the CRP regulon using in vitro and in vivo transcriptional profiling., Nucleic Acids Res 32(19):5874-93

RegulonDB