RegulonDB RegulonDB 10.9: Operon Form
   

argP operon and associated TUs in Escherichia coli K-12 genome




Operon      
Name: argP
This page displays every known transcription unit of this operon and their known regulation.


Transcription unit          
Name: argP
Synonym(s): iciA
Gene(s): argP   Genome Browser M3D Gene expression COLOMBOS
Note(s): In 1999 Celis proposed that ArgP binds to a region of 15 bp (GTCATAGTGCAGGAA) in the intergenic region of argP Celis RT.,1999. In contrast, the curator identified two contiguous conserved regions, an inverted repeat of 20 bp which may be the target sequence of ArgP, located at -36.5 (TATATGCAACCTGACACAAA) and -16.5 (ATTGTGTCATAGTGCAGGAA). The sequence proposed by Celis is included in the binding site located at -16.5. The curator identified the consensus sequence of ArgP and assigned the possible central position of these binding sites, based on similarity to consensus sequences.
ArgP has been identified as binding as a dimer of dimers in the intergenic region of dnaA in E. coli Lee Y,1997 and also in the regulatory region of gdhA of Klebsiella pneumoniae 18424527. For this reason, there is a possibility that this regulator transcriptionally regulates itself as a dimer of dimers.
Evidence: [BTEI] Boundaries of transcription experimentally identified
[ICWHO] Inferred computationally without human oversight
Reference(s): [1] Thony B., et al., 1991
Promoter
Name: argPp
+1: 3059730
Distance from start of the gene: 23
Sequence: gccgacggcttcggtatatgcaacctgacacaaaattgtgtcatagtgcaggaaaaagcaTttaccaggagcagacaacag
Evidence: [TIM]
Reference(s): [2] Han JS., et al., 1999
Terminator(s)
Type: rho-independent
Sequence: atcaaataatGCCTGATAGCACATATCAGGCgttgtcctca
Reference(s): [1] Thony B., et al., 1991
TF binding sites (TFBSs)
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal ArgP-arginine repressor argPp 3059684 3059704 -36.5 acggcttcggTATATGCAACCTGACACAAAAttgtgtcata nd [APIORCISFBSCS], [IC] [3]
proximal ArgP-arginine repressor argPp 3059704 3059723 -16.5 ctgacacaaaATTGTGTCATAGTGCAGGAAAaagcatttac nd [APIORCISFBSCS], [GEA], [IC] nd
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal PhoB-phosphorylated activator argPp 3059694 3059712 -27.0 tatatgcaacCTGACACAAAATTGTGTCATagtgcaggaa nd [APIORCISFBSCS], [GEA] [2]





RegulonDB