RegulonDB RegulonDB 11.2: Operon Form
   

argP operon and associated TUs in Escherichia coli K-12 genome




Operon      
Name: argP
This page displays every known transcription unit of this operon and their known regulation.


Transcription unit          
Name: argP
Synonym(s): iciA
Gene(s): argP   Genome Browser M3D Gene expression COLOMBOS
Note(s): In 1999 Celis proposed that ArgP binds to a region of 15 bp (GTCATAGTGCAGGAA) in the intergenic region of argP Celis RT.,1999. In contrast, the curator identified two contiguous conserved regions, an inverted repeat of 20 bp which may be the target sequence of ArgP, located at -36.5 (TATATGCAACCTGACACAAA) and -16.5 (ATTGTGTCATAGTGCAGGAA). The sequence proposed by Celis is included in the binding site located at -16.5. The curator identified the consensus sequence of ArgP and assigned the possible central position of these binding sites, based on similarity to consensus sequences.
ArgP has been identified as binding as a dimer of dimers in the intergenic region of dnaA in E. coli Lee Y,1997 and also in the regulatory region of gdhA of Klebsiella pneumoniae Goss TJ,2008. For this reason, there is a possibility that this regulator transcriptionally regulates itself as a dimer of dimers.
Evidence: [COMP-AINF] Inferred computationally without human oversight
[EXP-IDA-BOUNDARIES-DEFINED] Boundaries of transcription experimentally identified
Reference(s): [1] Thony B., et al., 1991
Promoter
Name: argPp
+1: 3059730
Distance from start of the gene: 23
Sequence: gccgacggcttcggtatatgcaacctgacacaaaattgtgtcatagtgcaggaaaaagcaTttaccaggagcagacaacag
Evidence: [EXP-IDA-TRANSCRIPTION-INIT-MAPPING]
Reference(s): [2] Han JS., et al., 1999
Terminator(s)
Type: rho-independent
Sequence: atcaaataatGCCTGATAGCACATATCAGGCgttgtcctca
Reference(s): [1] Thony B., et al., 1991
TF binding sites (TFBSs)
[ArgP,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal ArgP-L-arginine repressor argPp 3059684 3059704 -36.5 acggcttcggTATATGCAACCTGACACAAAAttgtgtcata nd [IC], [COMP-HINF-SIMILAR-TO-CONSENSUS], [IC] W [3]
proximal ArgP-L-arginine repressor argPp 3059704 3059723 -16.5 ctgacacaaaATTGTGTCATAGTGCAGGAAaaagcattta nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [IC], [COMP-HINF-SIMILAR-TO-CONSENSUS], [IC] W [3]
[PhoB,+] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal PhoB-phosphorylated activator argPp 3059694 3059712 -27.0 tatatgcaacCTGACACAAAATTGTGTCAtagtgcagga nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS] W [2]


Evidence    

 [EXP-IDA-TRANSCRIPTION-INIT-MAPPING] Transcription initiation mapping

 [IC] Inferred by curator

 [COMP-HINF-SIMILAR-TO-CONSENSUS] A person inferred or reviewed a computer inference of sequence function based on similarity to a consensus sequence.

 [EXP-IEP-GENE-EXPRESSION-ANALYSIS] Gene expression analysis


Reference(s)    

 [1] Thony B., Hwang DS., Fradkin L., Kornberg A., 1991, iciA, an Escherichia coli gene encoding a specific inhibitor of chromosomal initiation of replication in vitro., Proc Natl Acad Sci U S A 88(10):4066-70

 [2] Han JS., Park JY., Lee YS., Thony B., Hwang DS., 1999, PhoB-dependent transcriptional activation of the iciA gene during starvation for phosphate in Escherichia coli., Mol Gen Genet 262(3):448-52

 [3] Celis RT., 1999, Repression and activation of arginine transport genes in Escherichia coli K 12 by the ArgP protein., J Mol Biol 294(5):1087-95

RegulonDB