RegulonDB RegulonDB 10.10: Operon Form
   

aer operon and associated TUs in Escherichia coli K-12 genome




Operon      
Name: aer
This page displays every known transcription unit of this operon and their known regulation.


Transcription unit          
Name: aer
Gene(s): aer   Genome Browser M3D Gene expression COLOMBOS
Note(s): The trgp1 and aerp promoters are the only Escherichia coli σ28 promoters that are activated by CRP Hollands K,2010
J. Oberto in 2010 identified a possible binding site for NagC, GTTAATTATCTTGCCCAAAAATC, in the intergenic region of the divergent genes aer and patA. This demonstration was based on different statistical methods Oberto J.,2010 but it is not known if NagC regulates transcription in both directions.
Evidence: [AISGDTU] Automated inference that a single-gene directon is a transcription unit
Promoter
Name: aerp
+1: 3219120
Sigma Factor: Sigma28 Sigmulon
Distance from start of the gene: 44
Sequence: aattgcgatctaaatcaaattaatcggttaaagataaccgcagcggggccgacataaactCtgacaagaagttaacaacca
                             -35                -10         +1                   
Note(s): The conservation of the spacing between the DNA site for CRP and the -10 and -35 elements at the aer and trg promoters suggests that the mechanisms of transcription activation at the two promoters are similar Hollands K,2010
Evidence: [APIORCISFBSCS]
[HIPP]
[ICWHO]
[IHBCE]
[IMP]
[TIM]
Reference(s): [1] Chilcott GS., et al., 2000
[2] Hollands K., et al., 2010
[3] Huerta AM., et al., 2003
[4] Park K., et al., 2001
TF binding sites (TFBSs)
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal CRP-cyclic-AMP activator aerp 3219159 3219180 -49.5 ttaaatcgcaAATTGCGATCTAAATCAAATTAatcggttaaa nd [GEA], [AIBSCS], [BCE], [BPP], [SM] [5]
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal FNR activator aerp 3219163 3219176 -49.5 atcgcaaattGCGATCTAAATCAAattaatcggt nd [GEA], [AIBSCS] [6]





RegulonDB