RegulonDB RegulonDB 10.8: Operon Form
   

sodB operon and associated TUs in Escherichia coli K-12 genome




Operon      
Name: sodB
This page displays every known transcription unit of this operon and their known regulation.


Transcription unit          
Name: sodB
Gene(s): sodB   Genome Browser M3D Gene expression COLOMBOS
Note(s): The proteins Fur and HNS regulate the transcription of the sodB gene; although a Fur-binding site has been identified in the regulatory region of sodB, the regulation of the two regulators appears to be indirect 11782507 Transcriptional fusion experiments demonstrated a positive effect of Fur and a negative effect of HNS on sodB transcription 11782507. Niederhoffer EC,1990. Zhang Z,2005 and gel shift assays have shown a weak interaction between Fur and the regulatory region of sodB 11782507. Niederhoffer EC,1990 However, an in vitro transcription analysis demonstrated that Fur has no direct effect on the transcription of sodB 11782507 It should be noted that Fur regulates in a negative way RhyB, a small RNA that negatively regulates the expression of sodB Masse E,2002 On the other hand, the effect of HNS on the sodB promoter depends on the presence of Fur; in addition, no curved DNA region was identified to bind HNS around the promoter region of sodB 11782507
Promoter
Name: sodBp
+1: 1735323
Sigma Factor: Sigma70 Sigmulon
Distance from start of the gene: 55
Sequence: ttgttacggcaacagggtaagttcatcttttgtctcaccttttaatttgctaccctatccAtacgcacaataaggctattg
                              -35                  -10      +1                   
Note(s): This promoter is member of the extended -10 class of promoters.
The TSS in sodBp identified by Liu et al. (2018) using Capping-RACE differs by 2 bp from that identified by Carlioz et al. (1988) and Dubrac et al. (2000) Liu F,2018
Evidence: [CV(TA/TIM)]
[HTIM]
[IMP]
[TIM]
Reference(s): [1] Carlioz A., et al., 1988
[2] Dubrac S., et al., 2000
[3] Liu F., et al., 2018
Terminator(s)
Type: rho-independent
Sequence: ttgtcagcaaCTGTAACGCAGAAGGTTATCCTTCTGCGTTTTTgtttaattag
Reference(s): [1] Carlioz A., et al., 1988
TF binding sites (TFBSs)
[CRP,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
remote CRP-cAMP repressor sodBp 1735376 1735398 64.5 aggagagtagCAATGTCATTCGAATTACCTGCActaccatatg nd [AIBSCS], [CV(GEA/ROMA)], [GEA] [5]
[IHF,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal IHF1 repressor sodBp 1735256 1735268 -61.0 gctaaaacttTACCCTGTTGTTAcggcaacagg nd [AIBSCS], [CV(GEA/ROMA)], [GEA] [2]
[NsrR,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal NsrR repressor sodBp 1735281 1735292 -37.0 gcaacagggtAAGTTCATCTTTtgtctcacct nd [AIBSCS], [CV(GEA/ROMA)], [GEA] [4]
Note(s): 1IHF slightly represses the sodBp promoter.1IHF slightly represses the sodBp promoter.


Regulation by sRNA    
  Small RNA name (Regulator) Regulation type Mechanism Function Binding Sites Evidence Reference
LeftPos RightPos Sequence (RNA-strand)
  ryhB antisense post-transcriptional regulation repressor      
  fnrS antisense post-transcriptional regulation repressor 1735348 1735381 ATGCAAATTAATAATAAAGGAGAGTAGCAATGT [IMP] [6]
Notes: "The provided sequence is that of the RNA strand,i.e. 'U's are showed instead the 'T'"


RNA cis-regulatory element    
Regulation, transcriptional elongation  
Attenuator type: Transcriptional
Strand: forward
  Structure type Energy LeftPos RightPos Sequence (RNA-strand)
  terminator -18.8 1735251 1735295 cttcgctaaaACTTTACCCTGTTGTTACGGCAACAGGGTAAGTTCATCTTTTGTctcacctttt
  anti-terminator -4.53 1735222 1735260 gcgctcgtcgGGTAATGACCCCAAAAACACTTCGCTAAAACTTTACCCtgttgttacg
Notes: "The provided "Sequence" is that of the RNA strand, i.e. U's are shown instead of T's and regulators on the reverse strand will appear as the reverse complement of the sequence delimited by LeftPos-RigtPos"


Evidence    

 [CV(TA/TIM)] cross validation(TA/TIM)

 [HTIM] High-throughput transcription initiation mapping

 [IMP] Inferred from mutant phenotype

 [TIM] Transcription initiation mapping

 [AIBSCS] Automated inference based on similarity to consensus sequences

 [CV(GEA/ROMA)] cross validation(GEA/ROMA)

 [GEA] Gene expression analysis


Reference(s)    

 [1] Carlioz A., Ludwig ML., Stallings WC., Fee JA., Steinman HM., Touati D., 1988, Iron superoxide dismutase. Nucleotide sequence of the gene from Escherichia coli K12 and correlations with crystal structures., J Biol Chem 263(3):1555-62

 [2] Dubrac S., Touati D., 2000, Fur positive regulation of iron superoxide dismutase in Escherichia coli: functional analysis of the sodB promoter., J Bacteriol 182(13):3802-8

 [3] Liu F., Zheng K., Chen HC., Liu ZF., 2018, Capping-RACE: a simple, accurate, and sensitive 5' RACE method for use in prokaryotes., Nucleic Acids Res 46(21):e129

 [4] Partridge JD., Bodenmiller DM., Humphrys MS., Spiro S., 2009, NsrR targets in the Escherichia coli genome: new insights into DNA sequence requirements for binding and a role for NsrR in the regulation of motility., Mol Microbiol 73(4):680-94

 [5] Zhang Z., Gosset G., Barabote R., Gonzalez CS., Cuevas WA., Saier MH., 2005, Functional interactions between the carbon and iron utilization regulators, Crp and Fur, in Escherichia coli., J Bacteriol 187(3):980-90

 [6] Boysen A., Moller-Jensen J., Kallipolitis B., Valentin-Hansen P., Overgaard M., 2010, Translational regulation of gene expression by an anaerobically induced small non-coding RNA in Escherichia coli., J Biol Chem 285(14):10690-702

RegulonDB