RegulonDB RegulonDB 11.1: Operon Form
   

inaA operon and associated TUs in Escherichia coli K-12 genome




Operon      
Name: inaA
This page displays every known transcription unit of this operon and their known regulation.


Transcription unit          
Name: inaA
Gene(s): inaA   Genome Browser M3D Gene expression COLOMBOS
Note(s): Salicylate activates the inaAp and micFp promoters through Rob Chubiz LM, Glekas GD, Rao CV,2012
Promoter
Name: inaAp
+1: 2349499
Sigma Factor: Sigma70 Sigmulon
Distance from start of the gene: 27
Sequence: ttcattaatacgacacgtttcattaagattttcctcaggtaaccacctatagtcattgtcGttaataaaaatgacaggcga
                            -35                      -10    +1                   
Evidence: [COMP-AINF]
[COMP-HINF-POSITIONAL-IDENTIFICATION]
Reference(s): [1] Huerta AM., et al., 2003
[2] Martin RG., et al., 1999
TF binding sites (TFBSs)
[MarA,+] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal MarA activator inaAp 2349531 2349550 -41.5 attcattaatACGACACGTTTCATTAAGATtttcctcagg nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [2], [4], [5]
[Rob,+] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal Rob activator inaAp 2349531 2349550 -41.5 attcattaatACGACACGTTTCATTAAGATtttcctcagg nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [2], [6], [7]
[SoxS,+] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal SoxS activator inaAp 2349531 2349550 -41.5 attcattaatACGACACGTTTCATTAAGATtttcctcagg nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [2], [4], [5]
sRNA Interaction TU
sRNA TU Regulated Function Binding Sites Regulatory Mechanism Evidence (Confirmed, Strong, Weak) Reference(s)
PosLeft PosRight Target sequence (mRNA)
small regulatory RNA GcvB inaA repressor 2349421 2349444 CCUCUGUUGCCCACCAGUGAUUAA MRNA-DEGRADATION [EXP-IEP], [EXP-NUC-ACID-BINDING] [3]


RNA cis-regulatory element    
Regulation, transcriptional elongation  
Attenuator type: Translational
Strand: reverse
  Structure type Energy LeftPos RightPos Sequence (RNA-strand)
  terminator -12.9 2349475 2349514 caggtaaccaCCTATAGTCATTGTCGTTAATAAAAATGACAGGCGATAGggtatggcag
Notes: "The provided "Sequence" is that of the RNA strand, i.e. U's are shown instead of T's and regulators on the reverse strand will appear as the reverse complement of the sequence delimited by LeftPos-RigtPos"


Evidence    

 [COMP-AINF] Inferred computationally without human oversight

 [COMP-HINF-POSITIONAL-IDENTIFICATION] Human inference of promoter position

 [EXP-IEP-GENE-EXPRESSION-ANALYSIS] Gene expression analysis

 [COMP-HINF-SIMILAR-TO-CONSENSUS] A person inferred or reviewed a computer inference of sequence function based on similarity to a consensus sequence.

 [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] Binding of purified proteins

 [EXP-IEP] Inferred from expression pattern

 [EXP-NUC-ACID-BINDING] Nucleic acid binding evidence


Reference(s)    

 [1] Huerta AM., Collado-Vides J., 2003, Sigma70 promoters in Escherichia coli: specific transcription in dense regions of overlapping promoter-like signals., J Mol Biol 333(2):261-78

 [2] Martin RG., Gillette WK., Rhee S., Rosner JL., 1999, Structural requirements for marbox function in transcriptional activation of mar/sox/rob regulon promoters in Escherichia coli: sequence, orientation and spatial relationship to the core promoter., Mol Microbiol 34(3):431-41

 [3] Lalaouna D., Eyraud A., Devinck A., Prevost K., Masse E., 2019, GcvB small RNA uses two distinct seed regions to regulate an extensive targetome., Mol Microbiol 111(2):473-486

 [4] Martin RG., Rosner JL., 2011, Promoter discrimination at class I MarA regulon promoters mediated by glutamic acid 89 of the MarA transcriptional activator of Escherichia coli., J Bacteriol 193(2):506-15

 [5] Pomposiello PJ., Bennik MH., Demple B., 2001, Genome-wide transcriptional profiling of the Escherichia coli responses to superoxide stress and sodium salicylate., J Bacteriol 183(13):3890-902

 [6] Bennik MH., Pomposiello PJ., Thorne DF., Demple B., 2000, Defining a rob regulon in Escherichia coli by using transposon mutagenesis., J Bacteriol 182(13):3794-801

 [7] Wang Z., Xue T., Hu D., Ma Y., 2020, A Novel Butanol Tolerance-Promoting Function of the Transcription Factor Rob in Escherichia coli., Front Bioeng Biotechnol 8:524198

RegulonDB