![]() ![]() ![]() ![]() |
Name: | inaA | ||||||||||
Gene(s): | inaA Genome Browser M3D Gene expression COLOMBOS | ||||||||||
Note(s): | Salicylate activates the inaAp and micFp promoters through Rob Chubiz LM, Glekas GD, Rao CV,2012 | ||||||||||
Promoter | |||||||||||
Name: | inaAp | ||||||||||
+1: | 2349499 | ||||||||||
Sigma Factor: | Sigma70 Sigmulon | ||||||||||
Distance from start of the gene: | 27 | ||||||||||
Sequence: |
ttcattaatacgacacgtttcattaagattttcctcaggtaaccacctatagtcattgtcGttaataaaaatgacaggcga -35 -10 +1 |
||||||||||
Evidence: |
[COMP-AINF] [COMP-HINF-POSITIONAL-IDENTIFICATION] |
||||||||||
Reference(s): |
[1] Huerta AM., et al., 2003 [2] Martin RG., et al., 1999 |
Type | Transcription factor | Function | Promoter | Binding Sites | Growth Conditions | Evidence | Confidence level (C: Confirmed, S: Strong, W: Weak) | Reference(s) | |||
---|---|---|---|---|---|---|---|---|---|---|---|
LeftPos | RightPos | Central Rel-Pos | Sequence | ||||||||
proximal | MarA | activator | inaAp | 2349531 | 2349550 | -41.5 | attcattaatACGACACGTTTCATTAAGATtttcctcagg | nd | [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] | W | [2], [4], [5] |
Type | Transcription factor | Function | Promoter | Binding Sites | Growth Conditions | Evidence | Confidence level (C: Confirmed, S: Strong, W: Weak) | Reference(s) | |||
---|---|---|---|---|---|---|---|---|---|---|---|
LeftPos | RightPos | Central Rel-Pos | Sequence | ||||||||
proximal | Rob | activator | inaAp | 2349531 | 2349550 | -41.5 | attcattaatACGACACGTTTCATTAAGATtttcctcagg | nd | [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] | W | [2], [6], [7] |
Type | Transcription factor | Function | Promoter | Binding Sites | Growth Conditions | Evidence | Confidence level (C: Confirmed, S: Strong, W: Weak) | Reference(s) | |||
---|---|---|---|---|---|---|---|---|---|---|---|
LeftPos | RightPos | Central Rel-Pos | Sequence | ||||||||
proximal | SoxS | activator | inaAp | 2349531 | 2349550 | -41.5 | attcattaatACGACACGTTTCATTAAGATtttcctcagg | nd | [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] | W | [2], [4], [5] |
sRNA | TU Regulated | Function | Binding Sites | Regulatory Mechanism | Evidence (Confirmed, Strong, Weak) | Reference(s) | ||
---|---|---|---|---|---|---|---|---|
PosLeft | PosRight | Target sequence (mRNA) | ||||||
small regulatory RNA GcvB | inaA | repressor | 2349421 | 2349444 | CCUCUGUUGCCCACCAGUGAUUAA | MRNA-DEGRADATION | [EXP-IEP], [EXP-NUC-ACID-BINDING] | [3] |
RNA cis-regulatory element | ![]() |
---|
Regulation, transcriptional elongation | |
Attenuator type: | Translational |
Strand: | reverse |
Structure type | Energy | LeftPos | RightPos | Sequence (RNA-strand) | |
---|---|---|---|---|---|
terminator | -12.9 | 2349475 | 2349514 | caggtaaccaCCTATAGTCATTGTCGTTAATAAAAATGACAGGCGATAGggtatggcag |
Notes: "The provided "Sequence" is that of the RNA strand, i.e. U's are shown instead of T's and regulators on the reverse strand will appear as the reverse complement of the sequence delimited by LeftPos-RigtPos" |
Reference(s) |
![]() |
---|---|