RegulonDB RegulonDB 11.1: Operon Form
   

phoPQ operon and associated TUs in Escherichia coli K-12 genome




Operon      
Name: phoPQ
This page displays every known transcription unit of this operon and their known regulation.


Transcription unit          
Name: phoQ
Gene(s): phoQ   Genome Browser M3D Gene expression COLOMBOS
Note(s): The expression of the gene phoQ is increased under acidic growth conditions in either aerobiosis or microaerobiosis Marzan LW,2013 The increased expression under aerobiosis appears to be caused by the transcription factor PhoB Marzan LW,2013
Evidence: [IC] Inferred by curator
Promoter
Name: phoQp5
+1: 1189940
Sigma Factor: Sigma24 Sigmulon
Distance from start of the gene: 164
Sequence: ctgaccgcgttcgaatacactattatggaaacgttgatacgcaataatggcaaagtggtcAgcaaagattcgttaatgctc
                                  -35                 -10   +1                   
Evidence: [COMP-AINF]
Reference(s): [1] Huerta AM., et al., 2003
TF binding sites (TFBSs)
[PhoB,+] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
nd PhoB-phosphorylated activator phoQp5 nd nd nd nd nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS] W [2]


Transcription unit          
Name: phoPQ
Gene(s): phoQ, phoP   Genome Browser M3D Gene expression COLOMBOS
Note(s): The expression of the gene phoP is increased under acidic growth conditions in either aerobiosis or microaerobiosis Marzan LW,2013
Evidence: [EXP-IDA-BOUNDARIES-DEFINED] Boundaries of transcription experimentally identified
[EXP-IEP-COREGULATION] Inferred through co-regulation
Reference(s): [3] Kasahara M., et al., 1992
Promoter
Name: phoPp1
+1: 1190483
Distance from start of the gene: 36
Sequence: tttacctcccctccccgctggtttatttaatgtttacccccataaccacataatcgcgttAcactattttaataattaaga
Evidence: [EXP-IDA-TRANSCRIPTION-INIT-MAPPING]
Reference(s): [4] Eguchi Y., et al., 2004
[5] Kato A., et al., 1999
[6] Minagawa S., et al., 2003
TF binding sites (TFBSs)
[PhoP,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal PhoP-phosphorylated repressor phoPp1 1190508 1190524 -33.0 cctccccgctGGTTTATTTAATGTTTAcccccataac nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-AINF-SIMILAR-TO-CONSENSUS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [4], [5], [6], [9]
sRNA Interaction TU
sRNA TU Regulated Function Binding Sites Regulatory Mechanism Evidence (Confirmed, Strong, Weak) Reference(s)
PosLeft PosRight Target sequence (mRNA)
small regulatory RNA MicA phoPQ repressor 1190440 1190462 ACGCGCAUUUUUAUUUCUCCCUG TRANSLATION-BLOCKING, MRNA-DEGRADATION [EXP-IMP-SITE-MUTATION], [EXP-IPI] [7], [8]
small regulatory RNA GcvB phoPQ repressor 1190454 1190475 UUCUCCCUGUCUUAAUUAUUAA TRANSLATION-BLOCKING, MRNA-DEGRADATION [EXP-IEP], [EXP-IMP-SITE-MUTATION] [7]


Transcription unit       
Name: phoPQ
Gene(s): phoQ, phoP   Genome Browser M3D Gene expression COLOMBOS
Note(s): The expression of the gene phoP is increased under acidic growth conditions in either aerobiosis or microaerobiosis Marzan LW,2013
Evidence: [EXP-IEP-COREGULATION] Inferred through co-regulation
Reference(s): [3] Kasahara M., et al., 1992
Promoter
Name: phoPp3
+1: 1190491
Sigma Factor: Sigma32 Sigmulon
Distance from start of the gene: 44
Sequence: tttttcactttacctcccctccccgctggtttatttaatgtttacccccataaccacataAtcgcgttacactattttaat
                                   -35             -10      +1                   
Evidence: [COMP-AINF]
[COMP-AINF-POSITIONAL-IDENTIFICATION]
[COMP-AINF-SIMILAR-TO-CONSENSUS]
[EXP-IDA]
[EXP-IDA-TRANSCRIPTION-INIT-MAPPING]
[EXP-IEP]
Reference(s): [1] Huerta AM., et al., 2003
[10] Nonaka G., et al., 2006
[11] Wade JT., et al., 2006


Transcription unit          
Name: phoPQ
Gene(s): phoQ, phoP   Genome Browser M3D Gene expression COLOMBOS
Note(s): The expression of the gene phoP is increased under acidic growth conditions in either aerobiosis or microaerobiosis Marzan LW,2013 phoP expression is also induced under low-Mg2+ conditions and to a greater extent by the antimicrobial peptide C18G, in a PhoP-dependent manner Yadavalli SS,2016
Reference(s): [3] Kasahara M., et al., 1992
Promoter
Name: phoPp2
+1: 1190508
Distance from start of the gene: 61
Sequence: gattatccgctttttattttttcactttacctcccctccccgctggtttatttaatgtttAcccccataaccacataatcg
Evidence: [EXP-IDA-TRANSCRIPTION-INIT-MAPPING]
Reference(s): [4] Eguchi Y., et al., 2004
[5] Kato A., et al., 1999
[6] Minagawa S., et al., 2003
TF binding sites (TFBSs)
[PhoP,+] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal PhoP-phosphorylated activator phoPp2 1190508 1190524 -8.0 cctccccgctGGTTTATTTAATGTTTAcccccataac nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-AINF-SIMILAR-TO-CONSENSUS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [4], [5], [6], [9]


Evidence    

 [COMP-AINF] Inferred computationally without human oversight

 [EXP-IEP-GENE-EXPRESSION-ANALYSIS] Gene expression analysis

 [EXP-IDA-TRANSCRIPTION-INIT-MAPPING] Transcription initiation mapping

 [COMP-AINF-SIMILAR-TO-CONSENSUS] Automated inference based on similarity to consensus sequences

 [COMP-HINF-SIMILAR-TO-CONSENSUS] A person inferred or reviewed a computer inference of sequence function based on similarity to a consensus sequence.

 [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] Binding of purified proteins

 [EXP-IMP-SITE-MUTATION] Site mutation

 [EXP-IPI] Inferred from physical interaction

 [EXP-IEP] Inferred from expression pattern

 [COMP-AINF-POSITIONAL-IDENTIFICATION] Automated inference of promoter position

 [EXP-IDA] Inferred from direct assay


Reference(s)    

 [1] Huerta AM., Collado-Vides J., 2003, Sigma70 promoters in Escherichia coli: specific transcription in dense regions of overlapping promoter-like signals., J Mol Biol 333(2):261-78

 [2] Marzan LW., Hasan CM., Shimizu K., 2013, Effect of acidic condition on the metabolic regulation of Escherichia coli and its phoB mutant., Arch Microbiol 195(3):161-71

 [3] Kasahara M., Nakata A., Shinagawa H., 1992, Molecular analysis of the Escherichia coli phoP-phoQ operon., J Bacteriol 174(2):492-8

 [4] Eguchi Y., Okada T., Minagawa S., Oshima T., Mori H., Yamamoto K., Ishihama A., Utsumi R., 2004, Signal transduction cascade between EvgA/EvgS and PhoP/PhoQ two-component systems of Escherichia coli., J Bacteriol 186(10):3006-14

 [5] Kato A., Tanabe H., Utsumi R., 1999, Molecular characterization of the PhoP-PhoQ two-component system in Escherichia coli K-12: identification of extracellular Mg2+-responsive promoters., J Bacteriol 181(17):5516-20

 [6] Minagawa S., Ogasawara H., Kato A., Yamamoto K., Eguchi Y., Oshima T., Mori H., Ishihama A., Utsumi R., 2003, Identification and molecular characterization of the Mg2+ stimulon of Escherichia coli., J Bacteriol 185(13):3696-702

 [7] Coornaert A., Chiaruttini C., Springer M., Guillier M., 2013, Post-transcriptional control of the Escherichia coli PhoQ-PhoP two-component system by multiple sRNAs involves a novel pairing region of GcvB., PLoS Genet 9(1):e1003156

 [8] Coornaert A., Lu A., Mandin P., Springer M., Gottesman S., Guillier M., 2010, MicA sRNA links the PhoP regulon to cell envelope stress., Mol Microbiol 76(2):467-79

 [9] Monsieurs P., De Keersmaecker S., Navarre WW., Bader MW., De Smet F., McClelland M., Fang FC., De Moor B., Vanderleyden J., Marchal K., 2005, Comparison of the PhoPQ regulon in Escherichia coli and Salmonella typhimurium., J Mol Evol 60(4):462-74

 [10] Nonaka G., Blankschien M., Herman C., Gross CA., Rhodius VA., 2006, Regulon and promoter analysis of the E. coli heat-shock factor, sigma32, reveals a multifaceted cellular response to heat stress., Genes Dev 20(13):1776-89

 [11] Wade JT., Roa DC., Grainger DC., Hurd D., Busby SJ., Struhl K., Nudler E., 2006, Extensive functional overlap between sigma factors in Escherichia coli., Nat Struct Mol Biol 13(9):806-14

RegulonDB