RegulonDB RegulonDB 11.1: Operon Form
   

mutS operon and associated TUs in Escherichia coli K-12 genome




Operon      
Name: mutS
This page displays every known transcription unit of this operon and their known regulation.


Transcription unit       
Name: mutS
Gene(s): mutS   Genome Browser M3D Gene expression COLOMBOS
Note(s): Transcription of the mutS gene might be negatively regulated by σ38 through an intermediate regulator, as was shown in Tsui HC,1997 On other hand Hfq negatively regulates mutS expression, destabilizing its transcription during exponential growth.
A potential RNA G-quadruplex structure, formed by guanine-rich sequences located in the coding sequence region of the gene, was identified for mutS . This structure could regulate the expression of the gene, as observed for hemL gene expression Shao X, Zhang W, Umar MI, Wong HY, Seng Z, Xie Y, Zhang Y, Yang L, Kwok CK, Deng X,2020.
Evidence: [EXP-IDA-BOUNDARIES-DEFINED] Boundaries of transcription experimentally identified
[EXP-IDA-TRANSCRIPT-LEN-DETERMINATION] Length of transcript experimentally determined
[EXP-IMP-POLAR-MUTATION] Polar mutation
Reference(s): [1] Tsui HC., et al., 1997
Promoter
Name: mutSp
+1: 2857019
Sigma Factor: Sigma38 Sigmulon
Distance from start of the gene: 74
Sequence: accagcatcaagaactcgccgttcgcttcttcccctgaaatgattaactccggtatcatgTgcgccttatgtgattacaac
                              -35                -10        +1                   
Evidence: [COMP-AINF]
[EXP-IDA-TRANSCRIPTION-INIT-MAPPING]
[EXP-IEP]
Reference(s): [2] Huerta AM., et al., 2003
[3] Loewen PC., et al., 1998
[1] Tsui HC., et al., 1997
sRNA Interaction TU
sRNA TU Regulated Function Binding Sites Regulatory Mechanism Evidence (Confirmed, Strong, Weak) Reference(s)
PosLeft PosRight Target sequence (mRNA)
small regulatory RNA SdsR mutS repressor 2858477 2858501 CGCUGAAAGUUGGCUUUAAUGCGGU nd [EXP-IPI] [4]
small regulatory RNA ArcZ mutS repressor 2857067 2857078 AAUAUCAGGGAA nd [EXP-IEP], [EXP-IMP-SITE-MUTATION] [5]


Evidence    

 [COMP-AINF] Inferred computationally without human oversight

 [EXP-IDA-TRANSCRIPTION-INIT-MAPPING] Transcription initiation mapping

 [EXP-IEP] Inferred from expression pattern

 [EXP-IPI] Inferred from physical interaction

 [EXP-IMP-SITE-MUTATION] Site mutation


Reference(s)    

 [1] Tsui HC., Feng G., Winkler ME., 1997, Negative regulation of mutS and mutH repair gene expression by the Hfq and RpoS global regulators of Escherichia coli K-12., J Bacteriol 179(23):7476-87

 [2] Huerta AM., Collado-Vides J., 2003, Sigma70 promoters in Escherichia coli: specific transcription in dense regions of overlapping promoter-like signals., J Mol Biol 333(2):261-78

 [3] Loewen PC., Hu B., Strutinsky J., Sparling R., 1998, Regulation in the rpoS regulon of Escherichia coli., Can J Microbiol 44(8):707-17

 [4] Gutierrez A., Laureti L., Crussard S., Abida H., Rodriguez-Rojas A., Blazquez J., Baharoglu Z., Mazel D., Darfeuille F., Vogel J., Matic I., 2013, β-Lactam antibiotics promote bacterial mutagenesis via an RpoS-mediated reduction in replication fidelity., Nat Commun 4:1610

 [5] Chen J., Gottesman S., 2017, Hfq links translation repression to stress-induced mutagenesis in E. coli., Genes Dev 31(13):1382-1395

RegulonDB