![]() ![]() ![]() |
Name: | mutS | |||||||
Gene(s): | mutS Genome Browser M3D Gene expression COLOMBOS | |||||||
Note(s): | Transcription of the mutS gene might be negatively regulated by σ38 through an intermediate regulator, as was shown in Tsui HC,1997 On other hand Hfq negatively regulates mutS expression, destabilizing its transcription during exponential growth. A potential RNA G-quadruplex structure, formed by guanine-rich sequences located in the coding sequence region of the gene, was identified for mutS . This structure could regulate the expression of the gene, as observed for hemL gene expression Shao X, Zhang W, Umar MI, Wong HY, Seng Z, Xie Y, Zhang Y, Yang L, Kwok CK, Deng X,2020. |
|||||||
Evidence: | [EXP-IDA-BOUNDARIES-DEFINED] Boundaries of transcription experimentally identified [EXP-IDA-TRANSCRIPT-LEN-DETERMINATION] Length of transcript experimentally determined [EXP-IMP-POLAR-MUTATION] Polar mutation |
|||||||
Reference(s): | [1] Tsui HC., et al., 1997 | |||||||
Promoter | ||||||||
Name: | mutSp | |||||||
+1: | 2857019 | |||||||
Sigma Factor: | Sigma38 Sigmulon | |||||||
Distance from start of the gene: | 74 | |||||||
Sequence: |
accagcatcaagaactcgccgttcgcttcttcccctgaaatgattaactccggtatcatgTgcgccttatgtgattacaac -35 -10 +1 |
|||||||
Evidence: |
[COMP-AINF] [EXP-IDA-TRANSCRIPTION-INIT-MAPPING] [EXP-IEP] |
|||||||
Reference(s): |
[2] Huerta AM., et al., 2003 [3] Loewen PC., et al., 1998 [1] Tsui HC., et al., 1997 |
sRNA | TU Regulated | Function | Binding Sites | Regulatory Mechanism | Evidence (Confirmed, Strong, Weak) | Reference(s) | ||
---|---|---|---|---|---|---|---|---|
PosLeft | PosRight | Target sequence (mRNA) | ||||||
small regulatory RNA SdsR | mutS | repressor | 2858477 | 2858501 | CGCUGAAAGUUGGCUUUAAUGCGGU | nd | [EXP-IPI] | [4] |
small regulatory RNA ArcZ | mutS | repressor | 2857067 | 2857078 | AAUAUCAGGGAA | nd | [EXP-IEP], [EXP-IMP-SITE-MUTATION] | [5] |
Reference(s) |
![]() |
---|---|