RegulonDB RegulonDB 10.9: Operon Form
   

nmpC operon and associated TUs in Escherichia coli K-12 genome




Operon      
Name: nmpC
This page displays every known transcription unit of this operon and their known regulation.


Transcription unit          
Name: nmpC
Synonym(s): lc, phmA, phmA/nmpC
Gene(s): nmpC   Genome Browser M3D Gene expression COLOMBOS
Note(s): Based on microarray and RT-qPCR analyses, it was determined that the yebF and nmpC genes are up- and downregulated, respectively, upon exposure to glutathione (GSH) Goswami M,2018
Evidence: [LTED] Length of transcript experimentally determined
Reference(s): [1] Blasband AJ., et al., 1986
[2] Coll JL., et al., 1994
Promoter
Name: nmpCp
+1: 576870
Distance from start of the gene:
Sequence:
Evidence: [HIPP]
[TIM]
Reference(s): [1] Blasband AJ., et al., 1986
[2] Coll JL., et al., 1994
TF binding sites (TFBSs)
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal CRP-cAMP activator nmpCp 576891 576912 -31.5 aaccaaaactTACATCTTGAAATAATCACATTGattagatgaa nd [APIORCISFBSCS], [SM] [2]
proximal CRP-cAMP activator nmpCp 576933 576954 -73.5 gttcagataaAAATAGAGATCTACTTCACAAATcaaacgagaa nd [APIORCISFBSCS], [SM] [2]
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
remote IHF repressor nmpCp 577008 577020 -144.0 tataaattggCTAATAGATTTATTtttattcagc nd [APIORCISFBSCS], [SM] [2]
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
remote MprA repressor nmpCp 577021 577041 -161.0 cttataaataACAGCCGTTAATATAAATTGGCtaatagattt nd [AIBSCS] [4]
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal OmpR-P repressor nmpCp 576906 576925 -45.5 aaatcaaacgAGAAACCAAAACTTACATCTTgaaataatca nd [APIORCISFBSCS], [SM] [2]
sRNA Interaction TU
sRNA TU Regulated Function Binding Sites Regulatory Mechanism Evidence (Confirmed, Strong, Weak) Reference(s)
PosLeft PosRight Target sequence (mRNA)
small regulatory RNA RybB nmpC repressor 576806 576834 GCCACUGUUAAUUUUUUCAUCGUGAGCCC nd [SM] [3]





RegulonDB