![]() ![]() ![]() |
Name: | rpoS |
Gene(s): | rpoS Genome Browser M3D Gene expression COLOMBOS |
Note(s): | At the transcriptional level, (p)ppGpp positively affects rpoS transcript elongation and/or stability Lange R, Hengge-Aronis R,1991 The expression of the gene rpoS is increased under acidic growth conditions in either aerobiosis or microaerobiosis Marzan LW,2013 The increased expression under aerobiosis appears to be caused by the transcription factor PhoB Marzan LW,2013 but it is not known which promoter, of seven transcribing rpoS, is affected by PhoB. |
Evidence: | [IC] Inferred by curator |
Promoter | |
Name: | rpoSp1 |
+1: | 2867567 |
Distance from start of the gene: | 16 |
Sequence: |
tgccgcagcgataaatcggcggaaccaggcttttgcttgaatgttccgtcaagggatcacGggtaggagccaccttatgag |
Evidence: | [HTTIM] |
Reference(s): | [1] Mendoza-Vargas A., et al., 2009 |
Evidence: | [GEA] Gene expression analysis |
Reference(s): | [2] Gopalkrishnan S., et al., 2014 |
Name: | rpoS |
Gene(s): | rpoS Genome Browser M3D Gene expression COLOMBOS |
Note(s): | At the transcriptional level, (p)ppGpp positively affects rpoS transcript elongation and/or stability Lange R, Hengge-Aronis R,1991 The expression of the gene rpoS is increased under acidic growth conditions in either aerobiosis or microaerobiosis Marzan LW,2013 The increased expression under aerobiosis appears to be caused by the transcription factor PhoB Marzan LW,2013 but it is not known which promoter, of seven transcribing rpoS, is affected by PhoB. |
Evidence: | [IC] Inferred by curator |
Promoter | |
Name: | rpoSp2 |
+1: | 2867607 |
Distance from start of the gene: | 56 |
Sequence: |
attcgttacaaggggaaatccgtaaacccgctgcgttatttgccgcagcgataaatcggcGgaaccaggcttttgcttgaa |
Evidence: | [HTTIM] |
Reference(s): | [1] Mendoza-Vargas A., et al., 2009 |
Name: | rpoS |
Gene(s): | rpoS Genome Browser M3D Gene expression COLOMBOS |
Note(s): | At the transcriptional level, (p)ppGpp positively affects rpoS transcript elongation and/or stability Lange R, Hengge-Aronis R,1991 The expression of the gene rpoS is increased under acidic growth conditions in either aerobiosis or microaerobiosis Marzan LW,2013 The increased expression under aerobiosis appears to be caused by the transcription factor PhoB Marzan LW,2013 but it is not known which promoter, of seven transcribing rpoS, is affected by PhoB. |
Evidence: | [IC] Inferred by curator |
Promoter | |
Name: | rpoSp3 |
+1: | 2867654 |
Distance from start of the gene: | 103 |
Sequence: |
cgaccatgggtagcaccggaaccagttcaacacgcttgcattttgaaattcgttacaaggGgaaatccgtaaacccgctgc |
Evidence: | [HTTIM] |
Reference(s): | [1] Mendoza-Vargas A., et al., 2009 |
Name: | rpoS |
Gene(s): | rpoS Genome Browser M3D Gene expression COLOMBOS |
Note(s): | At the transcriptional level, (p)ppGpp positively affects rpoS transcript elongation and/or stability Lange R, Hengge-Aronis R,1991 The expression of the gene rpoS is increased under acidic growth conditions in either aerobiosis or microaerobiosis Marzan LW,2013 The increased expression under aerobiosis appears to be caused by the transcription factor PhoB Marzan LW,2013 but it is not known which promoter, of seven transcribing rpoS, is affected by PhoB. |
Evidence: | [IC] Inferred by curator |
Promoter | |
Name: | rpoSp4 |
+1: | 2867724 |
Distance from start of the gene: | 173 |
Sequence: |
agtgcctacgcccataacgacacaatgctggtccgggaacaacaagaagttaaggcggggCaaaaaatagcgaccatgggt |
Evidence: | [HTTIM] |
Reference(s): | [1] Mendoza-Vargas A., et al., 2009 |
Name: | rpoS | |||||||||
Gene(s): | rpoS Genome Browser M3D Gene expression COLOMBOS | |||||||||
Note(s): | Jung IL,2003demonstrated that both rpoS and katE gene expression, which codify a transcriptional regulator and a product essential for the detoxification against H2O2-induced stress, respectively, were absolutely dependent on polyamines during entry into the stationary phase. These data suggest that polyamines could be directly participating in the defense mechanism against oxidative stress. The expression of the rpoS gene is induced in cells that overexpress the fluoroquinolone transport system AcrAB, but the induction is delayed in AcrAB mutant cells Yang S, Lopez CR, Zechiedrich EL,2006 Under nitrogen-rich growth conditions, the expression of the rpoS gene was increased in mutants for two genes that encode two terminal oxidases, cyoA and cydB, and in mutants for two transcriptional regulators, Fnr and Fur. However, it is unknown if the effects of the transcriptional regulators act directly on gene expression Kumar R,2011 The expression of the gene rpoS is increased under acidic growth conditions in either aerobiosis or microaerobiosis Marzan LW,2013 The increased expression under aerobiosis appears to be caused by the transcription factor PhoB Marzan LW,2013 but it is not known which promoter, of seven transcribing rpoS, is affected by PhoB. Originally, Lange and colleagues found that rpoS was induced during the transition from exponential to stationary phase and was negatively regulated by cAMP Lange R, Hengge-Aronis R,1991 Based on gene expression analysis, it was determined that both IHF and Fis repress rpoS expression Amores GR,2017 However, McCann and colleagues observed that rpoS transcription was positively regulated by the cyaA gene McCann MP, Fraley CD, Matin A,1993 Later, Lange and colleagues showed that the transcription of rpoS is negatively regulated by cAMP-CRP Lange R, Hengge-Aronis R,1994 Recently, Guo and colleagues, based on site-directed mutagenesis experiments, found that both of the putative CRP-binding sites around the rpoS promoter are actually activation sites. Therefore, it is speculated that the negative effect of cAMP-CRP on rpoS in the early log phase is indirect. However, the binding interaction between CRP protein and the two putative binding sites requires further confirmation Guo M,2015 |
|||||||||
Evidence: | [PM] Polar mutation | |||||||||
Reference(s): |
[3] Lange R., et al., 1994 [4] Takayanagi Y., et al., 1994 |
|||||||||
Promoter | ||||||||||
Name: | rpoSp | |||||||||
+1: | 2868118 | |||||||||
Sigma Factor: | Sigma70 Sigmulon | |||||||||
Distance from start of the gene: | 567 | |||||||||
Sequence: |
gcctgcacaaaattccaccgttgctgttgcgtcgcaaccgacaattacgtattctgagtcTtcgggtgaacagagtgctaa -35 -10 +1 |
|||||||||
Note(s): | Takayanagi Y,1994 identified two promoters (P1 and P2) upstream from the rpoS gene. However, Lange R,1995tested both promoters and reported that only one of them seemed to be functional (P2). Based on this evidence and the fact that P1 is too far upstream from the rpoS gene (920 bp), we only uploaded P2 as rpoSp to EcoCyc. | |||||||||
Evidence: |
[HIPP] [ICWHO] [RS-EPT-CBR] [TIM] |
|||||||||
Reference(s): |
[5] Huerta AM., et al., 2003 [6] Lange R., et al., 1995 [7] Salgado H, et al., 2012 [4] Takayanagi Y., et al., 1994 |
Type | Transcription factor | Function | Promoter | Binding Sites | Growth Conditions | Evidence (Confirmed, Strong, Weak) | Reference(s) | |||
---|---|---|---|---|---|---|---|---|---|---|
LeftPos | RightPos | Central Rel-Pos | Sequence | |||||||
proximal | ArcA-phosphorylated | repressor | rpoSp | 2868088 | 2868102 | 24.0 | tgaacagagtGCTAACAAAATGTTGccgaacaaca | nd | [GEA], [BPP] | [19] |
proximal | ArcA-phosphorylated | repressor | rpoSp | 2868175 | 2868189 | -64.0 | agagcaaggaGTTGTGATCAAGCCTgcacaaaatt | nd | [GEA], [BPP] | [19] |
Type | Transcription factor | Function | Promoter | Binding Sites | Growth Conditions | Evidence (Confirmed, Strong, Weak) | Reference(s) | |||
---|---|---|---|---|---|---|---|---|---|---|
LeftPos | RightPos | Central Rel-Pos | Sequence | |||||||
remote | CRP-cyclic-AMP | repressor | rpoSp | 2868052 | 2868073 | 56.5 | acaacaagccAACTGCGACCACGGTCACAGCGcctgtaacgg | nd | [GEA], [BCE], [SM] | [20] |
proximal | CRP-cyclic-AMP | repressor | rpoSp | 2868170 | 2868191 | -62.5 | gcagagcaagGAGTTGTGATCAAGCCTGCACAaaattccacc | nd | [GEA], [BCE], [SM] | [20] |
sRNA | TU Regulated | Function | Binding Sites | Regulatory Mechanism | Evidence (Confirmed, Strong, Weak) | Reference(s) | ||
---|---|---|---|---|---|---|---|---|
PosLeft | PosRight | Target sequence (mRNA) | ||||||
small regulatory RNA OxyS | rpoS | repressor | nd | nd | nd | TRANSLATION-BLOCKING | [IMP] | [8], [9], [10] |
small regulatory RNA DsrA | rpoS | activator | 2867648 | 2867670 | GAUUUCCCCUUGUAACGAAUUUC | TRANSLATION-BLOCKING | [IEP] | [11], [12] |
small regulatory RNA ArcZ | rpoS | activator | 2867648 | 2867671 | GAUUUCCCCUUGUAACGAAUUUCA | TRANSLATION-BLOCKING | [IEP], [SM] | [11], [13] |
small regulatory RNA CyaR | rpoS | repressor | 2867671 | 2867685 | AAAAUGCAAGCGUGU | MRNA-DEGRADATION | [IDA], [IEP], [SM] | [14] |
small regulatory RNA RprA | rpoS | activator | 2867645 | 2867668 | ACGGAUUUCCCCUUGUAACGAAUU | TRANSLATION-BLOCKING | [IEP], [IMP], [SM] | [11], [15], [16], [17] |
Evidence: | [GEA] Gene expression analysis |
Reference(s): | [24] Gentry DR., et al., 1993 |
Name: | nlpD-rpoS |
Gene(s): | rpoS, nlpD Genome Browser M3D Gene expression COLOMBOS |
Evidence: | [PM] Polar mutation |
Reference(s): |
[3] Lange R., et al., 1994 [4] Takayanagi Y., et al., 1994 |
Promoter | |
Name: | nlpDp2 |
+1: | 2868782 |
Sigma Factor: | Sigma70 Sigmulon |
Distance from start of the gene: | 29 |
Sequence: |
gtatcgtgaacatcttttccagtgttcagtagggtgccttgcacggtaattatgtcactgGttattaaccaatttttcctg -35 -10 +1 |
Note(s): | The nlpD promoter region contributes to the low exponential-phase level of rpoS expression but apparently is not involved in growth phase-dependent induction of rpoS Lange R,1994. |
Evidence: |
[ICWHO] [TIM] |
Reference(s): |
[5] Huerta AM., et al., 2003 [3] Lange R., et al., 1994 |
Name: | nlpD-rpoS |
Gene(s): | rpoS, nlpD Genome Browser M3D Gene expression COLOMBOS |
Evidence: | [PM] Polar mutation |
Reference(s): |
[6] Lange R., et al., 1995 [3] Lange R., et al., 1994 [4] Takayanagi Y., et al., 1994 |
Promoter | |
Name: | nlpDp1 |
+1: | 2868829 |
Sigma Factor: | Sigma70 Sigmulon |
Distance from start of the gene: | 76 |
Sequence: |
gtgaggaaatacctggatttttcctggttattttgccgcaggtcagcgtatcgtgaacatCttttccagtgttcagtaggg -35 -10 +1 |
Note(s): | The nlpD promoter region contributes to the low exponential-phase level of rpoS expression but apparently is not involved in growth-phase-dependent induction of rpoS Lange R,1994. |
Evidence: |
[ICWHO] [TIM] |
Reference(s): |
[5] Huerta AM., et al., 2003 [3] Lange R., et al., 1994 |
RNA cis-regulatory element | ![]() |
---|
Regulation, transcriptional elongation | |
Attenuator type: | Translational |
Strand: | reverse |
Structure type | Energy | LeftPos | RightPos | Sequence (RNA-strand) | |
---|---|---|---|---|---|
terminator | -13.1 | 2867559 | 2867598 | cggaaccaggCTTTTGCTTGAATGTTCCGTCAAGGGATCACGGGTAGGAgccaccttat |
Notes: "The provided "Sequence" is that of the RNA strand, i.e. U's are shown instead of T's and regulators on the reverse strand will appear as the reverse complement of the sequence delimited by LeftPos-RigtPos" |
Reference(s) |
![]() |
---|---|