RegulonDB RegulonDB 11.1: Operon Form
   

nlpD-rpoS operon and associated TUs in Escherichia coli K-12 genome




Operon      
Name: nlpD-rpoS
This page displays every known transcription unit of this operon and their known regulation.


Transcription unit       
Name: rpoS
Gene(s): rpoS   Genome Browser M3D Gene expression COLOMBOS
Note(s): At the transcriptional level, (p)ppGpp positively affects rpoS transcript elongation and/or stability Lange R, Hengge-Aronis R,1991
The expression of the gene rpoS is increased under acidic growth conditions in either aerobiosis or microaerobiosis Marzan LW,2013 The increased expression under aerobiosis appears to be caused by the transcription factor PhoB Marzan LW,2013 but it is not known which promoter, of seven transcribing rpoS, is affected by PhoB.
Evidence: [IC] Inferred by curator
Promoter
Name: rpoSp1
+1: 2867567
Distance from start of the gene: 16
Sequence: tgccgcagcgataaatcggcggaaccaggcttttgcttgaatgttccgtcaagggatcacGggtaggagccaccttatgag
Evidence: [EXP-IDA-HPT-TRANSCR-INIT-M-RACE-MAP]
Reference(s): [1] Mendoza-Vargas A., et al., 2009
Allosteric regulation of RNA-polymerase
  Regulator Function Promoter target of RNApol Growth Conditions Note Evidence Reference
  DksA-ppGpp activation rpoSp1 nd   [EXP-IEP-GENE-EXPRESSION-ANALYSIS] [2]
Evidence: [EXP-IEP-GENE-EXPRESSION-ANALYSIS] Gene expression analysis
Reference(s): [2] Gopalkrishnan S., et al., 2014


Transcription unit       
Name: rpoS
Gene(s): rpoS   Genome Browser M3D Gene expression COLOMBOS
Note(s): At the transcriptional level, (p)ppGpp positively affects rpoS transcript elongation and/or stability Lange R, Hengge-Aronis R,1991
The expression of the gene rpoS is increased under acidic growth conditions in either aerobiosis or microaerobiosis Marzan LW,2013 The increased expression under aerobiosis appears to be caused by the transcription factor PhoB Marzan LW,2013 but it is not known which promoter, of seven transcribing rpoS, is affected by PhoB.
Evidence: [IC] Inferred by curator
Promoter
Name: rpoSp2
+1: 2867607
Distance from start of the gene: 56
Sequence: attcgttacaaggggaaatccgtaaacccgctgcgttatttgccgcagcgataaatcggcGgaaccaggcttttgcttgaa
Evidence: [EXP-IDA-HPT-TRANSCR-INIT-M-RACE-MAP]
Reference(s): [1] Mendoza-Vargas A., et al., 2009


Transcription unit       
Name: rpoS
Gene(s): rpoS   Genome Browser M3D Gene expression COLOMBOS
Note(s): At the transcriptional level, (p)ppGpp positively affects rpoS transcript elongation and/or stability Lange R, Hengge-Aronis R,1991
The expression of the gene rpoS is increased under acidic growth conditions in either aerobiosis or microaerobiosis Marzan LW,2013 The increased expression under aerobiosis appears to be caused by the transcription factor PhoB Marzan LW,2013 but it is not known which promoter, of seven transcribing rpoS, is affected by PhoB.
Evidence: [IC] Inferred by curator
Promoter
Name: rpoSp3
+1: 2867654
Distance from start of the gene: 103
Sequence: cgaccatgggtagcaccggaaccagttcaacacgcttgcattttgaaattcgttacaaggGgaaatccgtaaacccgctgc
Evidence: [EXP-IDA-HPT-TRANSCR-INIT-M-RACE-MAP]
Reference(s): [1] Mendoza-Vargas A., et al., 2009


Transcription unit       
Name: rpoS
Gene(s): rpoS   Genome Browser M3D Gene expression COLOMBOS
Note(s): At the transcriptional level, (p)ppGpp positively affects rpoS transcript elongation and/or stability Lange R, Hengge-Aronis R,1991
The expression of the gene rpoS is increased under acidic growth conditions in either aerobiosis or microaerobiosis Marzan LW,2013 The increased expression under aerobiosis appears to be caused by the transcription factor PhoB Marzan LW,2013 but it is not known which promoter, of seven transcribing rpoS, is affected by PhoB.
Evidence: [IC] Inferred by curator
Promoter
Name: rpoSp4
+1: 2867724
Distance from start of the gene: 173
Sequence: agtgcctacgcccataacgacacaatgctggtccgggaacaacaagaagttaaggcggggCaaaaaatagcgaccatgggt
Evidence: [EXP-IDA-HPT-TRANSCR-INIT-M-RACE-MAP]
Reference(s): [1] Mendoza-Vargas A., et al., 2009


Transcription unit          
Name: rpoS
Gene(s): rpoS   Genome Browser M3D Gene expression COLOMBOS
Note(s): Jung IL,2003demonstrated that both rpoS and katE gene expression, which codify a transcriptional regulator and a product essential for the detoxification against H2O2-induced stress, respectively, were absolutely dependent on polyamines during entry into the stationary phase. These data suggest that polyamines could be directly participating in the defense mechanism against oxidative stress.
The expression of the rpoS gene is induced in cells that overexpress the fluoroquinolone transport system AcrAB, but the induction is delayed in AcrAB mutant cells Yang S, Lopez CR, Zechiedrich EL,2006
Under nitrogen-rich growth conditions, the expression of the rpoS gene was increased in mutants for two genes that encode two terminal oxidases, cyoA and cydB, and in mutants for two transcriptional regulators, Fnr and Fur. However, it is unknown if the effects of the transcriptional regulators act directly on gene expression Kumar R,2011
The expression of the gene rpoS is increased under acidic growth conditions in either aerobiosis or microaerobiosis Marzan LW,2013 The increased expression under aerobiosis appears to be caused by the transcription factor PhoB Marzan LW,2013 but it is not known which promoter, of seven transcribing rpoS, is affected by PhoB.
Originally, Lange and colleagues found that rpoS was induced during the transition from exponential to stationary phase and was negatively regulated by cAMP Lange R, Hengge-Aronis R,1991 Based on gene expression analysis, it was determined that both IHF and Fis repress rpoS expression Amores GR,2017
However, McCann and colleagues observed that rpoS transcription was positively regulated by the cyaA gene McCann MP, Fraley CD, Matin A,1993 Later, Lange and colleagues showed that the transcription of rpoS is negatively regulated by cAMP-CRP Lange R, Hengge-Aronis R,1994 Recently, Guo and colleagues, based on site-directed mutagenesis experiments, found that both of the putative CRP-binding sites around the rpoS promoter are actually activation sites. Therefore, it is speculated that the negative effect of cAMP-CRP on rpoS in the early log phase is indirect. However, the binding interaction between CRP protein and the two putative binding sites requires further confirmation Guo M,2015
Evidence: [EXP-IMP-POLAR-MUTATION] Polar mutation
Reference(s): [3] Lange R., et al., 1994
[4] Takayanagi Y., et al., 1994
Promoter
Name: rpoSp
+1: 2868118
Sigma Factor: Sigma70 Sigmulon
Distance from start of the gene: 567
Sequence: gcctgcacaaaattccaccgttgctgttgcgtcgcaaccgacaattacgtattctgagtcTtcgggtgaacagagtgctaa
                                -35                    -10  +1                   
Note(s): Takayanagi Y,1994 identified two promoters (P1 and P2) upstream from the rpoS gene. However, Lange R,1995tested both promoters and reported that only one of them seemed to be functional (P2). Based on this evidence and the fact that P1 is too far upstream from the rpoS gene (920 bp), we only uploaded P2 as rpoSp to EcoCyc.
Evidence: [COMP-AINF]
[COMP-HINF-POSITIONAL-IDENTIFICATION]
[EXP-IDA-TRANSCRIPTION-INIT-MAPPING]
[RS-EPT-CBR]
Reference(s): [5] Huerta AM., et al., 2003
[6] Lange R., et al., 1995
[7] Salgado H, et al., 2012
[4] Takayanagi Y., et al., 1994
TF binding sites (TFBSs)
[ArcA,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal ArcA-phosphorylated repressor rpoSp 2868088 2868102 24.0 tgaacagagtGCTAACAAAATGTTGccgaacaaca nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [20]
proximal ArcA-phosphorylated repressor rpoSp 2868175 2868189 -64.0 agagcaaggaGTTGTGATCAAGCCTgcacaaaatt nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [20]
[CRP,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
remote CRP-cyclic-AMP repressor rpoSp 2868052 2868073 56.5 acaacaagccAACTGCGACCACGGTCACAGCGcctgtaacgg nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-IDA-BINDING-OF-CELLULAR-EXTRACTS], [EXP-IMP-SITE-MUTATION] W [21]
proximal CRP-cyclic-AMP repressor rpoSp 2868170 2868191 -62.5 gcagagcaagGAGTTGTGATCAAGCCTGCACAaaattccacc nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-IDA-BINDING-OF-CELLULAR-EXTRACTS], [EXP-IMP-SITE-MUTATION] W [21]
[Fur,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
nd Fur-Fe2+ repressor rpoSp nd nd nd nd nd [EXP-IEP], [EXP-IEP-GENE-EXPRESSION-ANALYSIS] W [23], [24]
[GadX,+] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
nd GadX activator rpoSp nd nd nd nd nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS] W [22]
[MqsA,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
remote MqsA repressor rpoSp 2868258 2868273 -147.0 gaacgttggtCAGACCTTGCAGGTGGgtaatgcttc nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS], [EXP-IMP-SITE-MUTATION] C [19]
sRNA Interaction TU
sRNA TU Regulated Function Binding Sites Regulatory Mechanism Evidence (Confirmed, Strong, Weak) Reference(s)
PosLeft PosRight Target sequence (mRNA)
small regulatory RNA OxyS rpoS repressor nd nd nd TRANSLATION-BLOCKING [EXP-IMP] [8], [9], [10]
small regulatory RNA DsrA rpoS activator 2867648 2867670 GAUUUCCCCUUGUAACGAAUUUC TRANSLATION-BLOCKING [EXP-IEP] [11], [12], [13]
small regulatory RNA ArcZ rpoS activator 2867648 2867671 GAUUUCCCCUUGUAACGAAUUUCA TRANSLATION-BLOCKING [EXP-IEP], [EXP-IMP-SITE-MUTATION] [11], [12], [14]
small regulatory RNA CyaR rpoS repressor 2867671 2867685 AAAAUGCAAGCGUGU MRNA-DEGRADATION [EXP-IDA], [EXP-IEP], [EXP-IMP-SITE-MUTATION] [15]
small regulatory RNA RprA rpoS activator 2867645 2867668 ACGGAUUUCCCCUUGUAACGAAUU TRANSLATION-BLOCKING [EXP-IEP], [EXP-IMP], [EXP-IMP-SITE-MUTATION] [11], [12], [16], [17], [18]
Allosteric regulation of RNA-polymerase
  Regulator Function Promoter target of RNApol Growth Conditions Note Evidence Reference
  ppGpp inhibition rpoSp nd   [EXP-IEP-GENE-EXPRESSION-ANALYSIS] [25]
Evidence: [EXP-IEP-GENE-EXPRESSION-ANALYSIS] Gene expression analysis
Reference(s): [25] Gentry DR., et al., 1993


Transcription unit       
Name: nlpD-rpoS
Gene(s): rpoS, nlpD   Genome Browser M3D Gene expression COLOMBOS
Evidence: [EXP-IMP-POLAR-MUTATION] Polar mutation
Reference(s): [3] Lange R., et al., 1994
[4] Takayanagi Y., et al., 1994
Promoter
Name: nlpDp2
+1: 2868782
Sigma Factor: Sigma70 Sigmulon
Distance from start of the gene: 29
Sequence: gtatcgtgaacatcttttccagtgttcagtagggtgccttgcacggtaattatgtcactgGttattaaccaatttttcctg
                              -35                   -10     +1                   
Note(s): The nlpD promoter region contributes to the low exponential-phase level of rpoS expression but apparently is not involved in growth phase-dependent induction of rpoS Lange R,1994.
Evidence: [COMP-AINF]
[EXP-IDA-TRANSCRIPTION-INIT-MAPPING]
Reference(s): [5] Huerta AM., et al., 2003
[3] Lange R., et al., 1994


Transcription unit       
Name: nlpD-rpoS
Gene(s): rpoS, nlpD   Genome Browser M3D Gene expression COLOMBOS
Evidence: [EXP-IMP-POLAR-MUTATION] Polar mutation
Reference(s): [6] Lange R., et al., 1995
[3] Lange R., et al., 1994
[4] Takayanagi Y., et al., 1994
Promoter
Name: nlpDp1
+1: 2868829
Sigma Factor: Sigma70 Sigmulon
Distance from start of the gene: 76
Sequence: gtgaggaaatacctggatttttcctggttattttgccgcaggtcagcgtatcgtgaacatCttttccagtgttcagtaggg
                                 -35                  -10   +1                   
Note(s): The nlpD promoter region contributes to the low exponential-phase level of rpoS expression but apparently is not involved in growth-phase-dependent induction of rpoS Lange R,1994.
Evidence: [COMP-AINF]
[EXP-IDA-TRANSCRIPTION-INIT-MAPPING]
Reference(s): [5] Huerta AM., et al., 2003
[3] Lange R., et al., 1994


RNA cis-regulatory element    
Regulation, transcriptional elongation  
Attenuator type: Translational
Strand: reverse
  Structure type Energy LeftPos RightPos Sequence (RNA-strand)
  terminator -13.1 2867559 2867598 cggaaccaggCTTTTGCTTGAATGTTCCGTCAAGGGATCACGGGTAGGAgccaccttat
Notes: "The provided "Sequence" is that of the RNA strand, i.e. U's are shown instead of T's and regulators on the reverse strand will appear as the reverse complement of the sequence delimited by LeftPos-RigtPos"


Evidence    

 [EXP-IDA-HPT-TRANSCR-INIT-M-RACE-MAP] High-throughput transcription initiation mapping

 [COMP-AINF] Inferred computationally without human oversight

 [COMP-HINF-POSITIONAL-IDENTIFICATION] Human inference of promoter position

 [EXP-IDA-TRANSCRIPTION-INIT-MAPPING] Transcription initiation mapping

 [RS-EPT-CBR] RNA-seq using two enrichment strategies for primary transcripts and consistent biological replicates

 [EXP-IEP-GENE-EXPRESSION-ANALYSIS] Gene expression analysis

 [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] Binding of purified proteins

 [EXP-IDA-BINDING-OF-CELLULAR-EXTRACTS] Binding of cellular extracts

 [EXP-IMP-SITE-MUTATION] Site mutation

 [EXP-IEP] Inferred from expression pattern

 [COMP-HINF] Inferred by a human based on computational evidence

 [EXP-IMP] Inferred from mutant phenotype

 [EXP-IDA] Inferred from direct assay


Reference(s)    

 [1] Mendoza-Vargas A., Olvera L., Olvera M., Grande R., Vega-Alvarado L., Taboada B., Jimenez-Jacinto V., Salgado H., Juarez K., Contreras-Moreira B., Huerta AM., Collado-Vides J., Morett E., 2009, Genome-wide identification of transcription start sites, promoters and transcription factor binding sites in E. coli., PLoS One 4(10):e7526

 [2] Gopalkrishnan S., Nicoloff H., Ades SE., 2014, Co-ordinated regulation of the extracytoplasmic stress factor, sigmaE, with other Escherichia coli sigma factors by (p)ppGpp and DksA may be achieved by specific regulation of individual holoenzymes., Mol Microbiol 93(3):479-93

 [3] Lange R., Hengge-Aronis R., 1994, The nlpD gene is located in an operon with rpoS on the Escherichia coli chromosome and encodes a novel lipoprotein with a potential function in cell wall formation., Mol Microbiol 13(4):733-43

 [4] Takayanagi Y., Tanaka K., Takahashi H., 1994, Structure of the 5' upstream region and the regulation of the rpoS gene of Escherichia coli., Mol Gen Genet 243(5):525-31

 [5] Huerta AM., Collado-Vides J., 2003, Sigma70 promoters in Escherichia coli: specific transcription in dense regions of overlapping promoter-like signals., J Mol Biol 333(2):261-78

 [6] Lange R., Fischer D., Hengge-Aronis R., 1995, Identification of transcriptional start sites and the role of ppGpp in the expression of rpoS, the structural gene for the sigma S subunit of RNA polymerase in Escherichia coli., J Bacteriol 177(16):4676-80

 [7] Salgado H, Peralta-Gil M, Gama-Castro S, Santos-Zavaleta A, Muñiz-Rascado L, García-Sotelo JS, Weiss V, Solano-Lira H, Martínez-Flores I, Medina-Rivera A, Salgado-Osorio G, Alquicira-Hernández S, Alquicira-Hernández K, López-Fuentes A, Porrón-Sotelo L, Huerta AM, Bonavides-Martínez C, Balderas-Martínez YI, Pannier L, Olvera M, Labastida A, Jiménez-Jacinto V, Vega-Alvarado L, Del Moral-Chávez V, Hernández-Alvarez A, Morett E, Collado-Vides J., 2012, RegulonDB v8.0: omics data sets, evolutionary conservation, regulatory phrases, cross-validated gold standards and more., Nucleic Acids Res.

 [8] Moon K., Gottesman S., 2011, Competition among Hfq-binding small RNAs in Escherichia coli., Mol Microbiol 82(6):1545-62

 [9] Updegrove TB., Wartell RM., 2011, The influence of Escherichia coli Hfq mutations on RNA binding and sRNA-mRNA duplex formation in rpoS riboregulation., Biochim Biophys Acta 1809(10):532-40

 [10] Zhang A., Altuvia S., Tiwari A., Argaman L., Hengge-Aronis R., Storz G., 1998, The OxyS regulatory RNA represses rpoS translation and binds the Hfq (HF-I) protein., EMBO J 17(20):6061-8

 [11] Chen J., To L., de Mets F., Luo X., Majdalani N., Tai CH., Gottesman S., 2021, A fluorescence-based genetic screen reveals diverse mechanisms silencing small RNA signaling in E. coli., Proc Natl Acad Sci U S A 118(27)

 [12] Mandin P., Gottesman S., 2010, Integrating anaerobic/aerobic sensing and the general stress response through the ArcZ small RNA., EMBO J 29(18):3094-107

 [13] Soper TJ., Woodson SA., 2008, The rpoS mRNA leader recruits Hfq to facilitate annealing with DsrA sRNA., RNA 14(9):1907-17

 [14] Soper T., Mandin P., Majdalani N., Gottesman S., Woodson SA., 2010, Positive regulation by small RNAs and the role of Hfq., Proc Natl Acad Sci U S A 107(21):9602-7

 [15] Kim W., Lee Y., 2020, Mechanism for coordinate regulation of rpoS by sRNA-sRNA interaction in Escherichia coli., RNA Biol 17(2):176-187

 [16] Kim W., Choi JS., Kim D., Shin D., Suk S., Lee Y., 2019, Mechanisms for Hfq-Independent Activation of rpoS by DsrA, a Small RNA, in Escherichia coli., Mol Cells 42(5):426-439

 [17] Majdalani N., Chen S., Murrow J., St John K., Gottesman S., 2001, Regulation of RpoS by a novel small RNA: the characterization of RprA., Mol Microbiol 39(5):1382-94

 [18] Majdalani N., Hernandez D., Gottesman S., 2002, Regulation and mode of action of the second small RNA activator of RpoS translation, RprA., Mol Microbiol 46(3):813-26

 [19] Wang X., Kim Y., Hong SH., Ma Q., Brown BL., Pu M., Tarone AM., Benedik MJ., Peti W., Page R., Wood TK., 2011, Antitoxin MqsA helps mediate the bacterial general stress response., Nat Chem Biol 7(6):359-66

 [20] Mika F., Hengge R., 2005, A two-component phosphotransfer network involving ArcB, ArcA, and RssB coordinates synthesis and proteolysis of sigmaS (RpoS) in E. coli., Genes Dev 19(22):2770-81

 [21] Amores GR., de Las Heras A., Sanches-Medeiros A., Elfick A., Silva-Rocha R., 2017, Systematic identification of novel regulatory interactions controlling biofilm formation in the bacterium Escherichia coli., Sci Rep 7(1):16768

 [22] Hommais F., Krin E., Coppee JY., Lacroix C., Yeramian E., Danchin A., Bertin P., 2004, GadE (YhiE): a novel activator involved in the response to acid environment in Escherichia coli., Microbiology 150(Pt 1):61-72

 [23] Hoerter JD., Arnold AA., Ward CS., Sauer M., Johnson S., Fleming T., Eisenstark A., 2005, Reduced hydroperoxidase (HPI and HPII) activity in the Deltafur mutant contributes to increased sensitivity to UVA radiation in Escherichia coli., J Photochem Photobiol B 79(2):151-7

 [24] Kumar R., Shimizu K., 2011, Transcriptional regulation of main metabolic pathways of cyoA, cydB, fnr, and fur gene knockout Escherichia coli in C-limited and N-limited aerobic continuous cultures., Microb Cell Fact 10:3

 [25] Gentry DR., Hernandez VJ., Nguyen LH., Jensen DB., Cashel M., 1993, Synthesis of the stationary-phase sigma factor sigma s is positively regulated by ppGpp., J Bacteriol 175(24):7982-9

RegulonDB