RegulonDB RegulonDB 11.1: Operon Form
   

oppABCDF operon and associated TUs in Escherichia coli K-12 genome




Operon      
Name: oppABCDF
This page displays every known transcription unit of this operon and their known regulation.


Transcription unit          
Name: oppABCDF
Synonym(s): OP00313, oppABCD
Gene(s): oppA, oppB, oppC, oppD, oppF   Genome Browser M3D Gene expression COLOMBOS
Note(s): The mRNA produced by the oppABCDF operon has been observed mainly in the poles of the cell Kannaiah S, Livny J, Amster-Choder O,2019.
Evidence: [EXP-IEP-COREGULATION] Inferred through co-regulation
Reference(s): [1] Andrews JC., et al., 1986
[2] Hiles ID., et al., 1987
Promoter
Name: oppAp
+1: 1301085
Sigma Factor: Sigma28 Sigmulon
Distance from start of the gene: 97
Sequence: atcgtctgaatcaccagaataaataaagtcggtgatagtaatacgtaacgataaagtaacCtgacagcagaaagtctccga
                           -35                 -10          +1                   
Evidence: [AS-NAS]
[COMP-AINF]
[COMP-AINF-POSITIONAL-IDENTIFICATION]
Reference(s): [1] Andrews JC., et al., 1986
[3] Fraenkel YM., et al., 1995
[4] Gama-Castro S., et al., 2008
[5] Huerta AM., et al., 2003
TF binding sites (TFBSs)
[ArcA,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
nd ArcA-phosphorylated repressor oppAp nd nd nd nd nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-AINF-SIMILAR-TO-CONSENSUS] W [10]
[Fur,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
remote Fur-Fe2+ repressor oppAp 1300940 1300958 -136.0 ctttattggtAATGAGAATAATTAACAATtaaagagcgt nd [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] nd [9]
[Lrp,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
remote Lrp repressor oppAp 1299260 1299274 -1818.0 tttcaaatgaAACGGAGCTGCCATGctccgtttac nd [EXP-IEP-RNA-SEQ], [EXP-CHIP-SEQ], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [8]
[ModE,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
nd ModE-molybdate repressor oppAp nd nd nd nd nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS] W [11]
sRNA Interaction TU
sRNA TU Regulated Function Binding Sites Regulatory Mechanism Evidence (Confirmed, Strong, Weak) Reference(s)
PosLeft PosRight Target sequence (mRNA)
small regulatory RNA GcvB oppABCDF repressor 1301163 1301202 UGAGGGAGUCCAAAAAACAAUGACCAACAUCACCAAGAGA TRANSLATION-BLOCKING [EXP-IGI] [6], [7]


Transcription unit       
Name: oppBCDF
Gene(s): oppB, oppC, oppD, oppF   Genome Browser M3D Gene expression COLOMBOS
Note(s): In addition to the transcriptional start site (TSS) of the appBp promoter, two more TSSs have been reported downstream of the ATG of appB; these could be the beginning of a transcript of appC and downstream genes, although they are too far from appC Masulis IS,2019.
Evidence: [EXP-IDA-BOUNDARIES-DEFINED] Boundaries of transcription experimentally identified
[EXP-IEP-COREGULATION] Inferred through co-regulation
[IC] Inferred by curator
Reference(s): [1] Andrews JC., et al., 1986
[12] Masulis IS., et al., 2019
Promoter
Name: oppBp
+1: 1302806
Distance from start of the gene: 93
Sequence: gtggctataccggcaaagatccgctggataatacctatacccggaatatgtacattgtgaAgcactaatggcaatacgtgg
Evidence: [EXP-IDA-TRANSCRIPTION-INIT-MAPPING]
Reference(s): [12] Masulis IS., et al., 2019


RNA cis-regulatory element    
Regulation, transcriptional elongation  
Attenuator type: Transcriptional
Strand: forward
  Structure type Energy LeftPos RightPos Sequence (RNA-strand)
  terminator -21.3 1302819 1302863 ctaatggcaaTACGTGGGGCAGGAGTGTCCTGCTCCACGGTGTCTGATTTTTATcgcattacag
  terminator -7.9 1301138 1301155 gattacacatGCTGGTTAATACCAGTAattataatga
  anti-terminator -10.9 1302779 1302832 tggataatacCTATACCCGGAATATGTACATTGTGAAGCACTAATGGCAATACGTGGGGCAGGagtgtcctgc
  anti-anti-terminator -19.32 1302730 1302798 gcgcgtctggTGAAACCGTGGGTTGGTGGCTATACCGGCAAAGATCCGCTGGATAATACCTATACCCGGAATATGTACattgtgaagc
Notes: "The provided "Sequence" is that of the RNA strand, i.e. U's are shown instead of T's and regulators on the reverse strand will appear as the reverse complement of the sequence delimited by LeftPos-RigtPos"


Evidence    

 [AS-NAS] Non-traceable author statement

 [COMP-AINF] Inferred computationally without human oversight

 [COMP-AINF-POSITIONAL-IDENTIFICATION] Automated inference of promoter position

 [EXP-IEP-GENE-EXPRESSION-ANALYSIS] Gene expression analysis

 [COMP-AINF-SIMILAR-TO-CONSENSUS] Automated inference based on similarity to consensus sequences

 [COMP-HINF-SIMILAR-TO-CONSENSUS] A person inferred or reviewed a computer inference of sequence function based on similarity to a consensus sequence.

 [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] Binding of purified proteins

 [EXP-IEP-RNA-SEQ] high throughput RNA-seq evidence

 [EXP-CHIP-SEQ] high throughput ChIP-seq evidence

 [EXP-IGI] Inferred from genetic interaction

 [EXP-IDA-TRANSCRIPTION-INIT-MAPPING] Transcription initiation mapping


Reference(s)    

 [1] Andrews JC., Short SA., 1986, opp-lac Operon fusions and transcriptional regulation of the Escherichia coli trp-linked oligopeptide permease., J Bacteriol 165(2):434-42

 [2] Hiles ID., Gallagher MP., Jamieson DJ., Higgins CF., 1987, Molecular characterization of the oligopeptide permease of Salmonella typhimurium., J Mol Biol 195(1):125-42

 [3] Fraenkel YM., Mandel Y., Friedberg D., Margalit H., 1995, Identification of common motifs in unaligned DNA sequences: application to Escherichia coli Lrp regulon., Comput Appl Biosci 11(4):379-87

 [4] Gama-Castro S., Jimenez-Jacinto V., Peralta-Gil M., Santos-Zavaleta A., Penaloza-Spinola MI., Contreras-Moreira B., Segura-Salazar J., Muniz-Rascado L., Martinez-Flores I., Salgado H., Bonavides-Martinez C., Abreu-Goodger C., Rodriguez-Penagos C., Miranda-Rios J., Morett E., Merino E., Huerta AM., Trevino-Quintanilla L., Collado-Vides J., 2008, RegulonDB (version 6.0): gene regulation model of Escherichia coli K-12 beyond transcription, active (experimental) annotated promoters and Textpresso navigation., Nucleic Acids Res 36(Database issue):D120-4

 [5] Huerta AM., Collado-Vides J., 2003, Sigma70 promoters in Escherichia coli: specific transcription in dense regions of overlapping promoter-like signals., J Mol Biol 333(2):261-78

 [6] Pulvermacher SC., Stauffer LT., Stauffer GV., 2008, The role of the small regulatory RNA GcvB in GcvB/mRNA posttranscriptional regulation of oppA and dppA in Escherichia coli., FEMS Microbiol Lett 281(1):42-50

 [7] Urbanowski ML., Stauffer LT., Stauffer GV., 2000, The gcvB gene encodes a small untranslated RNA involved in expression of the dipeptide and oligopeptide transport systems in Escherichia coli., Mol Microbiol 37(4):856-68

 [8] Kroner GM., Wolfe MB., Freddolino PL., 2019, Escherichia coli Lrp Regulates One-Third of the Genome via Direct, Cooperative, and Indirect Routes., J Bacteriol 201(3)

 [9] Chen Z., Lewis KA., Shultzaberger RK., Lyakhov IG., Zheng M., Doan B., Storz G., Schneider TD., 2007, Discovery of Fur binding site clusters in Escherichia coli by information theory models., Nucleic Acids Res 35(20):6762-77

 [10] Salmon KA., Hung SP., Steffen NR., Krupp R., Baldi P., Hatfield GW., Gunsalus RP., 2005, Global gene expression profiling in Escherichia coli K12: effects of oxygen availability and ArcA., J Biol Chem 280(15):15084-96

 [11] Tao H., Hasona A., Do PM., Ingram LO., Shanmugam KT., 2005, Global gene expression analysis revealed an unsuspected deo operon under the control of molybdate sensor, ModE protein, in Escherichia coli., Arch Microbiol 184(4):225-33

 [12] Masulis IS., Sukharycheva NA., Kiselev SS., Andreeva ZS., Ozoline ON., 2019, Between Computational Predictions and High-Throughput Transcriptional Profiling: in Depth Expression Analysis of the OppB Trans-Membrane Subunit of E. coli OppABCDF Oligopeptide Transporter., Res Microbiol


RegulonDB