RegulonDB RegulonDB 11.1: Operon Form
   

dppABCDF operon and associated TUs in Escherichia coli K-12 genome




Operon      
Name: dppABCDF
This page displays every known transcription unit of this operon and their known regulation.


Transcription unit          
Name: dppABCDF
Synonym(s): dpp, dppABCDE
Gene(s): dppF, dppD, dppC, dppB, dppA   Genome Browser M3D Gene expression COLOMBOS
Note(s): Similar to the opp operon in Salmonella and to the spoOK operon in Bacillus.
Although the ddpA-ddpB intergenic region is 310 bp, no message mRNA corresponding to ddpBCDF was observed.
It was experimentally demonstrated that the Rho protein negatively regulates expression of the genes dppA and dppB Hafeezunnisa M, Sen R,2020. Rho loading sites (rut sites) were identified upstream of dppA Hafeezunnisa M, Sen R,2020.
Evidence: [EXP-IDA-TRANSCRIPT-LEN-DETERMINATION] Length of transcript experimentally determined
[IC-ADJ-GENES-SAME-BIO-PROCESS] Products of adjacent genes in the same biological process
Reference(s): [1] Abouhamad WN., et al., 1994
Promoter
Name: dppAp
+1: 3707870
Sigma Factor: Sigma70 Sigmulon
Distance from start of the gene: 165
Sequence: tggtgtaaatcccggttggctgtattgacgttttcacattctgttgacagattgtaggtcAcgaggggcattttatggagg
                              -35                      -10  +1                   
Evidence: [COMP-AINF]
[COMP-HINF]
[EXP-IDA-HPT-TRANSCR-INIT-M-RACE-MAP]
[EXP-IDA-TRANSCRIPTION-INIT-MAPPING]
[RS-EPT-CBR]
Reference(s): [1] Abouhamad WN., et al., 1994
[2] Huerta AM., et al., 2003
[3] Maciag A., et al., 2011
[4] Salgado H, et al., 2012
TF binding sites (TFBSs)
[FNR,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
remote FNR repressor dppAp 3708026 3708039 -162.5 tcaccaaatgTTGCTAAATATTAAgctgattgtt nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-AINF-SIMILAR-TO-CONSENSUS] W [7]
[IHF,+] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
remote IHF activator dppAp 3706017 3706029 1848.0 aggcctacgaAAATTCTGCAATGtattgaattt nd [EXP-IDA-BINDING-OF-CELLULAR-EXTRACTS] nd nd
sRNA Interaction TU
sRNA TU Regulated Function Binding Sites Regulatory Mechanism Evidence (Confirmed, Strong, Weak) Reference(s)
PosLeft PosRight Target sequence (mRNA)
small regulatory RNA GcvB dppABCDF repressor 3707714 3707747 UCCAAUUGUGAUGUUUGUUGUUUUAACCCUUUGC TRANSLATION-BLOCKING [EXP-IGI] [5], [6]


RNA cis-regulatory element    
Regulation, transcriptional elongation  
Attenuator type: Translational
Strand: reverse
  Structure type Energy LeftPos RightPos Sequence (RNA-strand)
  terminator -11.7 3705810 3705834 gagcaatacaGACACGCAGTTCCAGGCTGCGGGTcactatagag
Notes: "The provided "Sequence" is that of the RNA strand, i.e. U's are shown instead of T's and regulators on the reverse strand will appear as the reverse complement of the sequence delimited by LeftPos-RigtPos"
REGULATION, RNA cis-regulatory element:  
Rfam type: Cis-reg
Strand: reverse
  Description Rfam score Left Pos Right Pos Sequence (RNA-strand)
  RtT RNA 105.7 3708448 3708581 caggcuuuuuUGCAUCUGCAGCUCAUGAGGAUGAGAACCUCCGGGGGCAGGGAGGUUCGACUCGAGCGAAGCGAGAGAACGUUGCGCCAGCAACGGCCCGCAGGGCGAGCCACGAAGUGGCGAGUAAUCCUCUAUCACCGACCAaauucgaaaa
Notes: "The provied "Sequence" is that of the RNA strand, i.e. U's are shown instead of T's and regulators on the reverse strand will appears as the reverse complement of the sequence delimited by LeftPos-RightPos"


Evidence    

 [COMP-AINF] Inferred computationally without human oversight

 [COMP-HINF] Inferred by a human based on computational evidence

 [EXP-IDA-HPT-TRANSCR-INIT-M-RACE-MAP] High-throughput transcription initiation mapping

 [EXP-IDA-TRANSCRIPTION-INIT-MAPPING] Transcription initiation mapping

 [RS-EPT-CBR] RNA-seq using two enrichment strategies for primary transcripts and consistent biological replicates

 [EXP-IEP-GENE-EXPRESSION-ANALYSIS] Gene expression analysis

 [COMP-AINF-SIMILAR-TO-CONSENSUS] Automated inference based on similarity to consensus sequences

 [EXP-IDA-BINDING-OF-CELLULAR-EXTRACTS] Binding of cellular extracts

 [EXP-IGI] Inferred from genetic interaction


Reference(s)    

 [1] Abouhamad WN., Manson MD., 1994, The dipeptide permease of Escherichia coli closely resembles other bacterial transport systems and shows growth-phase-dependent expression., Mol Microbiol 14(5):1077-92

 [2] Huerta AM., Collado-Vides J., 2003, Sigma70 promoters in Escherichia coli: specific transcription in dense regions of overlapping promoter-like signals., J Mol Biol 333(2):261-78

 [3] Maciag A., Peano C., Pietrelli A., Egli T., De Bellis G., Landini P., 2011, In vitro transcription profiling of the σS subunit of bacterial RNA polymerase: re-definition of the σS regulon and identification of σS-specific promoter sequence elements., Nucleic Acids Res 39(13):5338-55

 [4] Salgado H, Peralta-Gil M, Gama-Castro S, Santos-Zavaleta A, Muñiz-Rascado L, García-Sotelo JS, Weiss V, Solano-Lira H, Martínez-Flores I, Medina-Rivera A, Salgado-Osorio G, Alquicira-Hernández S, Alquicira-Hernández K, López-Fuentes A, Porrón-Sotelo L, Huerta AM, Bonavides-Martínez C, Balderas-Martínez YI, Pannier L, Olvera M, Labastida A, Jiménez-Jacinto V, Vega-Alvarado L, Del Moral-Chávez V, Hernández-Alvarez A, Morett E, Collado-Vides J., 2012, RegulonDB v8.0: omics data sets, evolutionary conservation, regulatory phrases, cross-validated gold standards and more., Nucleic Acids Res.

 [5] Pulvermacher SC., Stauffer LT., Stauffer GV., 2008, The role of the small regulatory RNA GcvB in GcvB/mRNA posttranscriptional regulation of oppA and dppA in Escherichia coli., FEMS Microbiol Lett 281(1):42-50

 [6] Urban JH., Vogel J., 2007, Translational control and target recognition by Escherichia coli small RNAs in vivo., Nucleic Acids Res 35(3):1018-37

 [7] Constantinidou C., Hobman JL., Griffiths L., Patel MD., Penn CW., Cole JA., Overton TW., 2006, A reassessment of the FNR regulon and transcriptomic analysis of the effects of nitrate, nitrite, NarXL, and NarQP as Escherichia coli K12 adapts from aerobic to anaerobic growth., J Biol Chem 281(8):4802-15

 [8] Beisel CL., Storz G., 2011, The base-pairing RNA spot 42 participates in a multioutput feedforward loop to help enact catabolite repression in Escherichia coli., Mol Cell 41(3):286-97

RegulonDB